1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kipish [7]
2 years ago
12

How many atoms in the pictured molecule can form hydrogen bonds with water molecules? there is a ball-and-stick model of nh2ch2c

h2oh molecule.how many atoms in the pictured molecule can form hydrogen bonds with water molecules? there is a ball-and-stick model of nh2ch2ch2oh molecule. 5 7 2 8 3?
Chemistry
1 answer:
MariettaO [177]2 years ago
4 0
The correct answer would be the third option. There would be two atoms that can form hydrogen bonds with the water molecules from the molecule NH2CH2CH2OH. The atoms O and N could make hydrogen bonds with H. Hydrogen bond is an intermolecular force that is a dipole-dipole interaction between a hydrogen and an atom of O, F and N.
You might be interested in
Which row probably contains the largest atoms on the periodic table?
svp [43]
The last row going across
7 0
3 years ago
An astronaut has a mass of 60kg. Calculate their weight When they are on the surface of the moon.
IceJOKER [234]

Answer:

I think 0kg because they are flying.

7 0
2 years ago
A fluid occupying has a mass of 4mg. Calculate its density and specific volume in SI, EE, and BG units.
kondaur [170]

The question is incomplete, complete question is:

A fluid occupying 3.2 m^3 of volume has a mass of 4 Mg. Calculate its density and specific volume in SI, EE, and BG units.

Explanation:

1) Mass of liquid = m = 4 Mg = 4 × 1,000 kg = 4,000 kg

(1 Mg = 1000 kg)

Volume of the fluid = V = 3.2 m^3

Density of the fluid = D

D=\frac{m}{V}=\frac{4,000 kg}{3.2 m^3}=1,250 kg/m^3

Specific volume is the reciprocal of the density :

V_{specific}=\frac{1}{Density}

Specific volume of the fluid = S_v

S_v=\frac{1}{D}=\frac{1}{1,250 kg/m^3}=0.0008 m^3/kg

2)

Density of the fluid in English Engineering units  = D (lb/ft^3)

1 kg = 2.20462 lb

1 m = 3.280 ft

D=\frac[1,250\times 2.20462 lb}{(3.280 ft)^3=78.95 lb/ft^3

Specific volume of the fluid :

=\frac{1}{78.95 lb/ft^3}=0.0127 ft^3/lb

3)

Density of the fluid in British Gravitational System units  = D (slug/ft^3)

1 kg = 0.06852 slug

1 m = 3.280 ft

D=\frac[1,250\times 0.0685218 slug}{(3.280 ft)^3=2.43 slug/ft^3

Specific volume of the fluid :

=\frac{1}{2.43 slug/ft^3}=0.412 ft^3/slug

7 0
3 years ago
Which accurately labels the lysosome?<br><br> W<br> X<br> Y<br> Z
xeze [42]
I am not sure about this but I think it’s y
7 0
2 years ago
Read 2 more answers
Antoinc Laurent Lavoisicr's contribution to chemistry was. a.the law of conservation of mass.
Ulleksa [173]

The answer for the following question is explained below.

The option for the following answer is "d".

Explanation:

The phlogiston theory of combustion:(Greek word phlogiston means <u><em>"BURN"</em></u>)

Phlogiston theory states that phlogisticated substances are the substances that contain  phlogiston and dephlogisticate when burned.

Dephlogisticating is the process of releasing  stored phlogiston,which is absorbed by the air.

Growing plants then absorb this phlogiston,which is why air does not spontaneously combust and also plant matte burns as well as it does.

The prevailing theory was that flammable materials contained a substance called phlogiston that was released during the combustion.

For example:

  • phlogiston was transferring into the surrounding air.
8 0
2 years ago
Other questions:
  • brainliest!!!!!!!!!!!!!!!! asap please What is Kepler-186f? a. telescope used to investigate outer space b.star in another solar
    12·1 answer
  • Read the chemical equation.
    10·2 answers
  • The second step to the scientific method is to state the "problem", the scientific question to be solved. What is one requiremen
    10·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • A balloon is inflated to a volume of 1.25L .If the temperature of the air inside is cooled from 35°C to 15°C , what will be the
    9·1 answer
  • Explain what happens when water reacts with sodium metal. Support your answer with the relevant
    10·1 answer
  • Calculate the percentage of water of crystallisation in MgSO⁴ 7H²O
    10·2 answers
  • 1. Write equations for the reaction of sodium with water and with dilute acids. (2 marks)​
    14·1 answer
  • Add a constant temperature when the volume of the gas is decreased what happens to its pressure
    6·1 answer
  • What does Newton's first law of motion state ​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!