1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
uysha [10]
3 years ago
5

About 3% of the water on Earth is freshwater. Only about 40% of that freshwater is available for human use. Why is so much fresh

water unavailable for human use?
Chemistry
2 answers:
Lesechka [4]3 years ago
6 0

Answer:

Because it is Frozen.

Explanation:

OverLord2011 [107]3 years ago
5 0
Because the freshwater is polluted.
You might be interested in
Will give brainliest
slamgirl [31]
I will help you with answering this question.
3 0
3 years ago
Water is heated to boiling and water vapor (steam) is released. Chemical change or physical change?
Vlad [161]
Physical because it is still H2O
6 0
3 years ago
Carnegie Development stages
Darya [45]

Answer:

Stage 1: 1 days.

Stage 2: 2-3 days.

Stage 3: 4-5 days.

Stage 4: 6 days.

Stage 5 (a-c): 7-12 days.

Stage 6: c. 17 days.

Stage 7: c. 19 days.

Stage 8: c. 23 days.

7 0
2 years ago
How is an exothermic reaction identified on a potential energy diagram?
Alla [95]
Energy diagrams are use to depict the energy changes that occur during a chemical reaction. There are two types of reaction based on the energy change, these are exothermic and endothermic reactions. In endothermic reactions energy are gained while in exothermic reactions energy are lost to the environment. To identify an exothermic reaction on a potential energy diagram, one has to compare the potential energy of the reactants and the products. If the potential energy of the product is less than that of the reactants, the reaction is exothermic.
4 0
3 years ago
PLEASE HELP DUE IN EXACTLY 15 mins!! i will give you branliest
Deffense [45]

2032533 \sq22222rt[2]{?}

4 0
2 years ago
Other questions:
  • Which option is an example of a chemical property?
    14·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Compared to compounds that possess only dipole-dipole intermolecular forces, compounds that possess hydrogen bonding generally:
    7·2 answers
  • What is the total number of electrons shared in a double covalent bond between two atoms?
    8·2 answers
  • Iron(II) sulfate, an iron supplement , FeSO4 Express your answer to four significant figures and include the appropriate units.
    15·1 answer
  • HH or Hh or hh??? help asap
    10·2 answers
  • Write the general formula of a. alkane b. aikyl radicals radicals
    10·1 answer
  • What pressure is required to compress 196.0 liters of air at 1.83 atmosphere into a cylinder whose volume is 26.0 liters
    13·1 answer
  • . How many grams of water would require 4400 joules
    14·1 answer
  • The graduated cylinder below shows major scale divisions every 5 mL. How should the volume of the liquid be recorded? Use the co
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!