1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
creativ13 [48]
3 years ago
8

Chlorophyll pigments are separated using paper. what is the stationary phase in this experiment

Chemistry
1 answer:
Llana [10]3 years ago
4 0
Paper is a stationary phase
You might be interested in
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
The process of ____ occurs when magma, lava, or a solute in a solution becomes a solid and the internal components will arrange
satela [25.4K]

Answer:

D. Crystallization

Explanation:

Let's clarify the irrelevant terms first.

  1. unification: This term has nothing to do with chemistry at all
  2. lithification: When the problem mentions magma and lava, you might think that this term is related to the process here. However, 'lithification' <em>do </em>have a precise meaning in geology. It refers to the process where sediments collapses into one single rock under pressure, which has nothing to do with the process mentioned here.

Now, for 2 terms that might confuse you: 'solidification' and 'crystallization' these also has precise scientific definition

Solidification is defined the process where substances in <em>liquid</em> phase changes its phase to <em>solid</em>. On first glance, this answer might seems correct, and yes, it is correct for this question. But not the <em>most</em> correct.

The keyword here is  

 'the internal components will arrange its self in an  organized pattern.'

Crystallization is a special case of Solidification where the atoms or molecules of liquid solidify by spontaneously arrange themselves in periodic, ordered, and organized pattern. It might or might not happen during solidification depending on cooling rate, viscosity of liquid, and other factors.

So, Crystallization is the most correct answer here.

4 0
3 years ago
The light reactions of photosynthesis use _____ and produce _____. The light reactions of photosynthesis use _____ and produce _
SashulF [63]
<h2>Input = NADP^+, water and Output = NADPH + O_2</h2>

Explanation:

The light reactions of photosynthesis use water and produce Oxygen, NADPH.

The equation for photosynthesis :

6 CO_2 + 6 H_2O → C_6H_12O_6 + 6 O_2

The process of photosynthesis in two stages -

  • The first stage is called the light reaction in which the light energy from the sun is captured and converted into chemical energy stored in the form of ATP and NADPH
  • The second stage is the process of conversion of ATP molecules to sugar or glucose (the Calvin Cycle)

For a light reaction -

Net Input is of, NADP^+, Light, Water, ADP

Net Output is of, ATP, NADPH, O_2

8 0
3 years ago
which factors are needed to determine the amount of heat absorbed by an aluminum cube after it is warmed? check all that apply
Deffense [45]

Answer:

Explanation:

final temperature of the cube

initial temperature of the cube

mass of the cube

specific heat of aluminum

4 0
3 years ago
Describe how the height of the tides changes from Monday to Thursday.
adoni [48]
One of the results is that the moon is near the earth and the other one, the oceans tide. Even though the earth can hold any object within
ts proximity, the ocean is partly attracted due to its liquid property. At night, the ocean tends to be attracted to the moon by creating a bulge and assigning it as ‘high tide’. This is due to the strong gravitational pull of th moon to the earth.

I hope this helps!
This might be right..
5 0
4 years ago
Other questions:
  • PLEASE HELP ME ON HERE HAVING TROUBLE!!!!<br> What errors tend to lead to pseudoscience?
    6·1 answer
  • Why does a metallic ion produce a characteristic color?
    12·1 answer
  • What is the formula for CaS
    8·1 answer
  • Explain how you determine molar mass of Ca(No3)2
    15·1 answer
  • How many moles of aqueous sodium ions and sulfide are formed when 2.50 mil of sodium sulfide dissolved in water.
    7·1 answer
  • Mass is an accurate measure of weight. true or false
    7·2 answers
  • Which element in Group 15 has the greatest metallic character?
    11·1 answer
  • Ill give u brainliest help asap!
    8·2 answers
  • Hi help me pleaseeeeeee
    15·1 answer
  • Calcium propionate [Ca(CH₃CH₂COO)₂; calcium propanoate] is a mold inhibitor used in food, tobacco, and pharmaceuticals.(a) Use b
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!