1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vaselesa [24]
3 years ago
5

Consider the reaction below.

Chemistry
1 answer:
saw5 [17]3 years ago
6 0

This answer to this question is a rule that is applied to any reaction taken at dynamic equilibrium, with respect to 500 K. In other words, you can say that this reaction is of no use to us -

In a chemical equilibrium, it is known that the forward and reverse reactions occur at equal rates. At this point the concentrations of products and reactants remain constant, or in other words do not change

<u><em>Solution = Option C</em></u>

You might be interested in
1.For the reaction P4 O10(s) + 6H2O(l) → 4H3PO4(aq), what mass of P
Alex17521 [72]
P₄O₁₀ + 6H₂O → 4H₃PO₄
The equation shows us that the molar ratio of
P₄O₁₀ : 6H₂O = 1:6

We also know that one mole of a substance contains 6.02 x 10²³ particles. We can use this to calculate the moles of water.
moles(H₂O) = (5.51 x 10²³) / (6.02 x 10²³)
= 0.92 mole
That means moles of P₄O₁₀ = 0.92 / 6
= 0.15

Each mole of P₄O₁₀ contains 4 moles of P. 
moles(P) = 4 x 0.15 = 0.6 mol
Mr of P = 207 grams per mol
Mass of P = 207 x 0.6
= 124.2 grams
5 0
3 years ago
Read 2 more answers
Suggest why it might be difficult and dangerous to test sodium for electrical conductivity?​
lukranit [14]

Answer:

It might cause fire or extreme smoke.

Explanation:

8 0
2 years ago
HELP ASAP ILL GIVE BRAINLIEST!!
Dahasolnce [82]

Of course we would experience them.

3 0
3 years ago
Which of the following is a physical property? A. Flammability B. Heat of combustion C. Solubility D.Toxicity
Rasek [7]

I think it would be solubility but I’m not sure

6 0
3 years ago
Read 2 more answers
To filter or trickle through a porous substance
zubka84 [21]

Answer:

percolate

hope this helps :)

6 0
3 years ago
Other questions:
  • When standardizing an iodine solution, 30.37 ml of the solution was required to completely oxidize 10.00 ml of a 5 mg/ml solutio
    11·1 answer
  • An ideal sample weighing 1.28g at 127C (temp) and 1 atm has a volume of 0.250L. Determine the molar mass of the gas.
    9·1 answer
  • 11.39g PbCl2(s) 200.0 ML<br> Solve for m
    7·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Which of the following is equal to 4 kilograms?
    12·2 answers
  • Pressure drop in packed column ..... a tray column
    7·1 answer
  • Why should distilled water be used when conducting chemical tests?
    8·1 answer
  • A dm^3 is equal to how many cm^3
    8·1 answer
  • C4H10+ 02 → CO2 +H2O <br> balance the equation
    9·1 answer
  • A 45.0 mL solution of 0.0450 M hydroxylamine is extracted with 125 mL of solvent. The distribution constant for the reaction is
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!