Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Isn't a chemical change like something that's not a physical change or physically changed but is something that uses natural chemicals? that's my guess sorry if it's wrong I think I'm wrong though
Conduction - by touch
Convection - hot air rises, cold air sinks
Insulation - to insulate or capture heat
Radiation - by waves
Direct contact means touch, therefore the answer would be conduction.
To test for hydrogen, burn a candle near the suspected source of hydrogen. If you hear a squeaky pop sound, hydrogen is present because when hydrogen gas burns, it makes a squeaky pop sound.
