1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
adell [148]
3 years ago
12

I really appreciate I need help

Chemistry
2 answers:
Troyanec [42]3 years ago
7 0

They do this in case the road is to freeze or overheat causing cracks and such, it keeps a stronger bind within the pavement.

Leno4ka [110]3 years ago
3 0
The bridge is completely surrounded by cold air in the winter and by hot air in the summer. It is not insulated by the ground beneath it
You might be interested in
How many moles are in 12.9 grams of Fe?
amid [387]

Answer:

0.1677 is the answer

Explanation:

6 0
2 years ago
Read 2 more answers
How do you find the mass of an object?
krek1111 [17]

Answer:

density/volume

Explanation:

Divide the object’s weight by the acceleration of gravity to find the mass.

8 0
3 years ago
Read 2 more answers
What happens when the vapor pressure of a liquid is equal to the external pressure? The liquid freezes The intermolecular forces
Makovka662 [10]

Answer:

The liquid boils.

Explanation:

Vapor pressure is simply defined as the pressure exerted on a substance (solid/liquid) by the vapor of the substance collected just at the top of the surface of the substance. In concise words, it is the pressure of Vapor that is in contact with its solid or liquid state.

For a liquid, it is the pressure of the Vapor gathering at the top of the surface of the liquid.

When this Vapor pressure matches the external pressure, the temperature stays constant and the molecules of the liquid all through the liquid can gain enough energy, rise to the surface of the liquid and break free in gaseous form; thereby, boiling.

The definition of boiling point basically explains that it is the point at which temperature stays constant, and the vapour pressure of the liquid matches the atmospheric/external pressure around the liquid and its liquid molecules change into vapor.

This is why liquids boil faster at higher altitudes; the atmospheric pressure at higher altitudes is reduced, hence, the temperature at which liquid boils at this high altitude is normally lower than its known boiling point temperature.

It is also why food cooks to a temperature higher than the boiling point of water in a pressure cooker/pot. The added pressure ensures that the cooking water boils at temperatures higher than its boiling point; thereby exposing the cooking ingredients to a higher temperature, leading to faster cooking.

Hence, it is obvious why boiling is the answer to this question.

6 0
3 years ago
URGENT!
irga5000 [103]

Answer:

GAY-LUSSAC'S LAW.

Explanation:

P1 = 765 torr

T1 = 23°C = 296K

P2 = 560. torr

T2 = ?

(765 torr)/(296K) = (560. torr)/ T2

T2 = 226 K = -57°C

7 0
3 years ago
The specific heat of copper is 0.385 j/g°c which equation would you use
cestrela7 [59]
Since there's specific heat, you should use Q=mc△T. Depends on if this question also involves phase change or not, you might will need Lf (latent heat of fusion) or Lv (latent heat of vaporisation).
8 0
3 years ago
Other questions:
  • What is Corona virus And explain breifly in​
    15·1 answer
  • The equilibrium system Co(H2O)62+ + 4Cl– ⇌ CoCl42– + 6H2O is endothermic as written, meaning heat is a reactant for the forward
    13·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • The element iodine forms a(n) _______ with the charge . The symbol for this ion is , and the name is . The number of electrons i
    11·1 answer
  • What is the atomic mass of an atom that has 6 protons, 6 neutrons, and 6 electrons?
    12·1 answer
  • In IR spectroscopy, we normally talk about "frequencies" when in reality we are referring to wavenumbers. What is the mathematic
    14·1 answer
  • 1 Point
    12·1 answer
  • Hello, I'm on a test can you guys help me answer this question? I'll mark brainliest to whoever has a good answer
    5·1 answer
  • Only some particles split up into smaller particles
    11·1 answer
  • The theoretical yield of zinc oxide in a reaction is 486 g. what is the percent
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!