Answer:
Explanation:
An atom is the smallest unit of an element that can take part in a chemical reaction. Atoms (and there corresponding symbols) mentioned in the question are
Lithium ⇒ Li
Carbon ⇒ C
Nitrogen ⇒ N
Potassium ⇒ K
Oxygen ⇒ O
Iron ⇒ Fe
Chlorine ⇒ Cl
A compound is substance that contains two or more atoms that are chemically combined and can be represented with a chemical formula. The compounds (and there corresponding formula) mentioned in the question are
Water ⇒ H₂O
Edible salt (sodium chloride) ⇒ NaCl
Chalk (calcium carbonate) ⇒ CaCO₃
Lime (calcium oxide) ⇒ CaO
Iodides (such as sodium iodide and potassium iodide) ⇒ NaI and KI respectively
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
The correct answer is B) Chlorine, Sulfur, and Silicon
I'm 100% sure this is correct
Brainliest please!!!
<span>6.38x10^-2 moles
First, let's determine how many moles of gas particles are in the two-liter container. The molar volume for 1 mole at 25C and 1 atmosphere is 24.465 liters/mole. So
2 L / 24.465 L/mol = 0.081749438 mol
Now air doesn't just consist of nitrogen. It also has oxygen, carbon dioxide, argon, water vapor, etc. and the total number of moles includes all of those other gasses. So let's multiply by the percentage of nitrogen in the atmosphere which is 78%
0.081749438 mol * 0.78 = 0.063764562 mol.
Rounding to 3 significant figures gives 6.38x10^-2 moles</span>