1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Georgia [21]
3 years ago
7

Characteristics of bipolar disorder typically include

Chemistry
2 answers:
crimeas [40]3 years ago
7 0

The correct answer is option b, that is, difficulty concentrating.  

Manic depression also called bipolar disorder refers to a mental disorder, which leads to periods of unusually elevated mood and the periods of depression. The elevated mood is substantial and is called hypomania or mania, on the basis of its severity, or whether the signs of psychosis are there.  

One of the usual sign of bipolar disorder is the difficulty in concentrating or diminished the tendency to think and indecisiveness. The individual suffering with the condition seems to make wrong decisions due to this sign, and as they do not think completely, the patients suffering from bipolar disorder possess poor decision making.  


I am Lyosha [343]3 years ago
3 0
C. Difficulty in concentrating. 
One of the common symptom for Bipolar disorder is the difficulty in concentration or decreased ability to think and indecisiveness. They tend to make wrong decisions because of this symptom. And because they do not think thoroughly, bipolar disorder patients have poor decision making.
You might be interested in
Please help me:) thanks!
Cloud [144]

Answer:

2Cl2 has 4 atoms

NaOH has 3 atoms

CaCO3 has 5 atoms

Explanation:

4 0
2 years ago
Read 2 more answers
1. Lithium, water, edible salt, chalk, Carbon, Lime, Nitrogen, Potassium, Oxygen,
Kaylis [27]

Answer:

Explanation:

An atom is the smallest unit of an element that can take part in a chemical reaction. Atoms (and there corresponding symbols) mentioned in the question are

Lithium ⇒ Li

Carbon ⇒ C

Nitrogen ⇒ N

Potassium ⇒ K

Oxygen ⇒ O

Iron ⇒ Fe

Chlorine ⇒ Cl

A compound is substance that contains two or more atoms that are chemically combined and can be represented with a chemical formula. The compounds (and there corresponding formula) mentioned in the question are

Water ⇒ H₂O

Edible salt (sodium chloride) ⇒ NaCl

Chalk (calcium carbonate) ⇒ CaCO₃

Lime (calcium oxide) ⇒ CaO

Iodides (such as sodium iodide and potassium iodide) ⇒ NaI and KI respectively

8 0
2 years ago
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
3 years ago
Listed below are sets of elements.
Anna11 [10]
The correct answer is B) Chlorine, Sulfur, and Silicon

I'm 100% sure this is correct

Brainliest please!!!
7 0
3 years ago
Read 2 more answers
Part b an "empty" container is not really empty if it contains air. how may moles of nitrogen are in an "empty" two-liter cola b
Sedbober [7]
<span>6.38x10^-2 moles
       First, let's determine how many moles of gas particles are in the two-liter container. The molar volume for 1 mole at 25C and 1 atmosphere is 24.465 liters/mole. So
   2 L / 24.465 L/mol = 0.081749438 mol
       Now air doesn't just consist of nitrogen. It also has oxygen, carbon dioxide, argon, water vapor, etc. and the total number of moles includes all of those other gasses. So let's multiply by the percentage of nitrogen in the atmosphere which is 78%
    0.081749438 mol * 0.78 = 0.063764562 mol.
        Rounding to 3 significant figures gives 6.38x10^-2 moles</span>
4 0
3 years ago
Read 2 more answers
Other questions:
  • Which of these species are free radicals? check all that apply. check all that apply. no2 no o o2 o3?
    14·1 answer
  • Which of the following contains plasma?
    6·2 answers
  • How are physical and chemical changes similar?
    13·2 answers
  • Someone please help!! i don’t know how to do this
    13·1 answer
  • Which of the following will react violently with water to form a base?
    11·1 answer
  • How do you determine the difference between a living specimen and a nonliving one?
    7·1 answer
  • Write a balanced equation for the combustion of C7H16(l) (heptane) -- i.e. its reaction with O2(g) forming the products CO2(g) a
    6·1 answer
  • ASAP will get Brainiest<br> question in pic ( multiple select )
    5·2 answers
  • What scientist use the scientific method to determine if cold was a substance?
    15·1 answer
  • C. Balance these fossil-fuel combustion reactions. (1 point)
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!