1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DENIUS [597]
3 years ago
13

Which of the following describes a homogeneous mixture? (2 points) Question 18 options: 1) It can be separated by chemical means

but not by physical means. 2) It cannot be separated by either chemical or physical means. 3) It can be separated by physical means and is uniform in composition. 4) It can be separated by physical means and is not uniform in composition.
Chemistry
2 answers:
Svetllana [295]3 years ago
7 0

It can be separated by physical means and is not uniform in composition.

Ghella [55]3 years ago
5 0

Answer: Option (3) is the correct answer.

Explanation:

A mixture that consists of two or more substances mixed in uniform composition then it is known as a homogeneous mixture.

For example, NaCl dissolved in water is a homogeneous mixture.

There will be equal composition of NaCl and water. Therefore, we can obtain NaCl crystals from this solution by evaporating the water.

Hence, we can conclude that the statement it can be separated by physical means and is uniform in composition, describes a homogeneous mixture.

You might be interested in
When chemists convert ethene (C2H2) to ethanol (CH3CH2OH), they have a mixture of the two gaseous substances. Why do chemists th
emmainna [20.7K]

Answer:

to collect liquid ethanol and leave ethene as a gas because ethanol has hydrogen bonds    

Explanation:

The chemist would be lesser than the temperature of the mixture as to collect the liquid ethanol and then leave ethene as a gas since the ethanol is a bond that should be hydrogen. Also -OH that available in the ethanol would be responsible for the hydrogen bonds also it is the main and significant molecular forice

So as per the given situation the above represent the answer

3 0
3 years ago
State the law of multiple proportions.
Fofino [41]
Statement that when two elements combine with each other to from more than one compound, the weights of one element that combine with a fixed weight of the other are in a ratio of small whole numbers.
8 0
3 years ago
Read 2 more answers
Dalton's contribution was different from thatof the ancient Greek who postulated the existence of atoms. Point out the differenc
ELEN [110]

Answer: Democritus atomic theory is the ancient theory that describes the nature of matter in terms of atoms whereas Dalton atomic theory is a modern scientific theory that describes the nature of matter in terms of atoms. According to Dalton's theory, atoms are identically same, but Democritus had no idea about it. Atoms are never created nor destroyed, they just rearrange.

Explanation:

4 0
3 years ago
What percentage of the heat lost by the hot object(s) was gained by the water? Explain at least three factors that might have ca
amid [387]

sorry I don't know just kidding I know just kidding I don't know

6 0
2 years ago
What are the coefficients when the chemical equation below is balanced?
timofeeve [1]

Answer:

C is correct

Explanation:

4 0
3 years ago
Other questions:
  • How many atoms are there in 5.699 g of cobalt, Co? Express your answer with the appropriate significant figures and unit.
    12·1 answer
  • What is always true of a weak acid ?
    9·2 answers
  • NaCl<br> Quantity of element
    13·2 answers
  • What is the key difference between a liquid and a gas?
    6·2 answers
  • What is the half-life of a 12 g sample of radioisotope that decayed to 6 g in 28
    7·1 answer
  • 3. What is the density of a 100 grams (g) box that displaces 20 mL of water?
    7·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Which statement is correct about the water cycle?
    14·1 answer
  • 2. What states of matter exist within the human body? What state of matter do you think your body is mostly made up of? Why? (4
    6·1 answer
  • system of equations You and your friend are making 30 liters of sodium water. You have liters of 10% sodium and your friend has
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!