1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amm1812
3 years ago
6

When water dissolves salt, which process is not involved?

Chemistry
2 answers:
Mariana [72]3 years ago
4 0
What are the list of processes?
tatiyna3 years ago
3 0

Answer:

Ionization.

Explanation:

You might be interested in
Is this right?????????????????????
aleksley [76]

C and D are correct. This is the process of replication, and option E refers to repetition.

7 0
3 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
A system receives 575 ) of heat and delivers 425 ) of work. Calculate the change in the internal energy. AE, of the system.​
vfiekz [6]

Answer:

ΔE = 150 J

Explanation:

From first law of thermodynamics, we know that;

ΔE = q + w

Where;

ΔE is change in internal energy

q is total amount of heat energy going in or coming out

w is total amount of work expended or received

From the question, the system receives 575 J of heat. Thus, q = +575 J

Also, we are told that the system delivered 425 J of work. Thus, w = -425 J since work was expended.

Thus;

ΔE = 575 + (-425)

ΔE = 575 - 425

ΔE = 150 J

7 0
3 years ago
What is one takeaway you have about future sea levels rising ?
Galina-37 [17]

Answer:

Our world will never be the same. Our beaches will be submerged, many towns, cities, states, and even countries will be partially if not completely submerged. All these human cities being flooded will kill thousands of people, pollute the ocean, and lose billions of dollars.

Explanation:

7 0
2 years ago
Read 2 more answers
What is the best way to<br> determine which brand of<br> paper towel is the<br> strongest when wet?
luda_lava [24]

Answer:Bounty

Explanation:After being soaked, the Bounty towel held an impressive 43 ounces or 2.69 pounds.

Did this help?

4 0
2 years ago
Other questions:
  • A solution with a hydroxide ion concentration of 4.15 × 10-3 m is ________ and has a hydrogen ion concentration of ________.
    6·1 answer
  • Calculate the approximate enthalpy of the reaction in joules. Estimate that 1.0 mL of vinegar has the same thermal mass as 1.0 m
    11·1 answer
  • A sample of an ideal gas at 1.00 atm and a volume of 1.73 L was placed in a weighted balloon and dropped into the ocean. As the
    14·1 answer
  • Why do solids react faster in powder form than in lump form
    7·1 answer
  • The type of response when a plant moves away from the stimulus
    8·1 answer
  • Some alkenes have geometric (cis-trans) isomers because ________. all of the carbon atoms in the compound are rigid and cannot r
    5·1 answer
  • He distance from Earth to the North Star is about 430 light-years. Which of the following statements describes why scientists us
    14·1 answer
  • A hot air ballon contains 270L of helium at 24C and 845 mmHg. WHat will be the volume of the ballon at -50c and pressure of 0.73
    11·1 answer
  • Predict what would happen if plants disappear?
    9·1 answer
  • SO2+02➡SO3 <br>balance chemical equation​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!