1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
forsale [732]
3 years ago
6

Objects placed together eventually reach the same temperature. when you go into a room and touch a piece of metal in that room,

it feels colder than a piece of plastic. explain. 2. what is meant by the term lower in energy? which is
Chemistry
1 answer:
Naily [24]3 years ago
4 0

Answer:

1. The plastic is poor conductor of electricity

Explanation:

Indeed when two objects are placed in a room, there'll be flow of energy between the objects and the air in the room until all of them are at the same temperature. So when a person touches a metal that has been sitting in a room and it feels colder than a plastic bag at the same temperature because the moment he touches the metal, which is a good conductor of heat, it immediately starts conducting heat away from his hand leaving his hand with the sensation of "coldness". However when you  touch a plastic, a poor conductor, it does not feel as cold because it is conducting very little heat from the hand.

You might be interested in
An oxygen atom has a mass of 2.66 x 10^-23 g and a glass of water has a mass of 0.050kg. Use this information to answer the ques
fomenos
<h2>ANSWER OF EACH PART ARE GIVEN BELOW</h2>

Explanation:

A)

We know, each mole contains N_A= 6.023 \times 10^{23} atoms.

It is given that mass of one oxygen atom is m= 2.66\times 10^{-23}\ g.

Therefore, mass of one mole of oxygen, M=m\times N_A.

Putting value of n and N_A,

M=2.66\times 10^{-23}\times 6.023\times 10^{23} \ gm\\M=16.0\ gm

B)

Given,

Mass of water in glass=0.050 kg = 50 gm.

From above part mass of one mole of oxygen atoms = 16.0 gm.

Therefore, number of mole of oxygen equivalent to 50 gm oxygen=\dfrac{50}{16}=3.1 \ moles.

LEARN MORE :

Avogadro's number

brainly.com/question/12902286

3 0
3 years ago
PLEASE HELP:<br><br> iron reacts with nitrogen to form iron(III) nitride
lutik1710 [3]

Answer:

2Fe +N_{2} -> 2FeN

Explanation:

Iron is Fe, nitrogen is N. Nitrogen is diatomic, which means it occurs as a molecular pair by itself. Iron III nitride has a chemical formula of FeN because nitrogen has a charge of 3-, and iron III tells us the iron has a charge of 3+ so you just need one of each to make the charges balance and the compound neutral.

3 0
2 years ago
Write electron configurations for Gallium, Ga (Z=31), and show the total valence electrons
ivann1987 [24]

<u>Answer:</u> The electronic configuration of gallium is written below and number of valence electrons is 3.

<u>Explanation:</u>

Electronic configuration is defined as the representation of electrons around the nucleus of an atom.

Number of electrons in an atom is determined by the atomic number of that atom.

Valence electrons are defined as the electrons present in the outermost shell of an atom.

We are given:

An element Gallium having atomic number as 31.

Number of electrons = 31

Electronic configuration of Gallium is: (Z=31):1s^22s^22p^63s^23p^64s^23d^{10}4p^1

This element has 3 electrons in its outermost shell. So, the number of valence electrons is 3

Hence, the electronic configuration of gallium is written below and number of valence electrons is 3.

3 0
3 years ago
What is the pOH of a solution with [OH-] = 1.4 x 10-13?
lukranit [14]

Answer:

C. 12.85

Explanation:

just did

4 0
3 years ago
λmax for the π → π* transition in ethylene is 170 nm. Is the HOMO-LUMO energy difference in ethylene greater than or less than t
-Dominant- [34]

Answer:

the HOMO-LUMO energy difference in ethylene is greater than that of cis,trans−1,3−cyclooctadiene

Explanation:

The λmax is the wavelength of maximum absorption. We could use it to calculate the HOMO-LUMO energy difference as follows:

For ethylene

E= hc/λ= 6.63×10^-34×3×10^8/170×10^-9= 1.17×10^-18J

For cis,trans−1,3−cyclooctadiene

E= hc/λ=6.63×10^-34×3×10^8/230×10^-9=8.6×10^-19J

Therefore, the HOMO-LUMO energy difference in ethylene is greater than that of cis,trans−1,3−cyclooctadiene

8 0
3 years ago
Other questions:
  • Conductive definition science term
    6·1 answer
  • An indicator of average kinetic energy is
    6·1 answer
  • Do covalent bonds dissolve in methanol
    12·1 answer
  • Consider the diagram of the Earth, Sun, and Moon system. Which phenomenon is MOST DIRECTLY caused by the revolution of the Earth
    6·1 answer
  • Alpha and beta particles and gamma rays are examples of:
    15·1 answer
  • What was the result of the atomic theory?
    11·1 answer
  • Look at the two thermometers.
    11·2 answers
  • Explain how the mucles and other organs are dependent on the brain
    6·1 answer
  • Which chromosome cause apples to be a `paticular` color?
    7·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!