1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sveta_85 [38]
3 years ago
8

Select the correct answer.

Chemistry
2 answers:
Marysya12 [62]3 years ago
8 0

Answer:

I think the correct answer is (c)

Explanation:

rusak2 [61]3 years ago
6 0
I think the answer to this A but I’m not rlly sure
You might be interested in
Pls, Help!!!!!!!
yKpoI14uk [10]

Answer:

Element A = Oxygen

Element H =

Element B = Aluminum

Element J = Magnesium

Element C = Selenium

Element L = Carbon

Element D = Sodium

Element Q = Francium

Element F = Antimony

Element R = Calcium

Element G = Chlorine

Element S = Tellurium

Explanation:

Element A  is Oxygen because: oxygen 6 valence electrons ; is a gas at room temperature ; and is transported in blood to cells.

Element H  is Neon because: Neon is a noble gas ;   qppears as red light when charged with  electricity (Neon light signs)  and it has the second highest Ionization energy of the elements

Element B  is Aluminum because: Aluminum is a metal and its ion has charge of +3. It is also located on the borders of the Metalloid staircase .

Element J  is Magnesium because its ion has charge of 2+ and is  isoelectronic with Neon  because it loses two electrons to now have 10 electrons.

Element C  is Selenium because its ion that has a charge of -2  is formed by gaining two electrons in order to have 36 electrons which is isoelectronic with Kr ypton

Element L  is Carbon because carbon has the smallest atomic radius of any member in the Carbon family  because it is the first member of the family and atomic radius increases on going down the group.

Element D  is Sodium because its ion has charge of +1  and it has 2 inner core levels , the 1 and 2 energy levels.

Element Q  is Francium because it has the largest radius and lowest ionization  energy of any element

Element F  is Antimony. It is a member of Nitrogen family  and has the second highest ionization energy level in family .

Element R  is calcium because its on has charge of +2  which is isoelectronic with Argon . Calcium also has atomic radius is larger than Ar gon.

Element G  is Chlorine. It has the second to the smallest radius of elements in the 3rd period  as the second to the last element in the period because atomic radius decreases across a period from left to right.

Element S  is Tellurium. It has atomic mass larger than Iodine just to the right  of it and is found in the 5th period

4 0
3 years ago
Which of the following statements is not correct?
velikii [3]
To answer the question above, multiply the given number of moles by the molar masses.

(A)     (0.20 mole) x (32 g / 1 mole) = 6.4 grams O2
(B)     (0.75 mole) x (62 g / 1 mole) = 46.5 grams H2CO3
(C)     (3.42 moles) x (28 g / 1 mole) = 95.7 grams CO
(D)     (4.1 moles) x (29.88 g / 1 mole) = 122.508 g Li2O

The answer to the question above is letter D.
4 0
4 years ago
Question:
Elina [12.6K]

H2SO4 + ZN ------- ZNSO4+ H2

(SO4)²The sulphate salt is formed......

Hope it helps

8 0
3 years ago
Please help I will give brainliest
SOVA2 [1]

Answer:

Explanation:

c. - vaccine

b. - immunity

d. - phagocyte

f. - b cell

e. - t cells

a. active immunity

8 0
3 years ago
What does it means when your boyfriend doesnt talk to you ​
d1i1m1o1n [39]
Either he’s busy, or he is just trying to ignore you.

Need more info tho
7 0
4 years ago
Other questions:
  • What is a pentadihide?
    15·1 answer
  • If I start with 5 grams of c3h8 what is my theoretical yield of water
    9·1 answer
  • What happens to the temperature of water when the average kinetic energy of its particles decreases
    9·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Compare the relative charge and mass of each of the subatomic particles? pleaseeee help me this is for a homework in my chemistr
    5·1 answer
  • Calculate the mass in grams 3.00 moles Na
    15·1 answer
  • Why should impure zinc be used instead of pure zinc in preparation of hydrogen gas​
    9·2 answers
  • Explain why the CO2 from your breath had the effect on the pH of water that it did. Explain any anomalies in your experiment.
    8·1 answer
  • Which salt is not formed from metal ions. NaCl, BaSO4, SrCl2, NH4OH
    6·2 answers
  • Which of the following best describes the forces when there are different-sized forces from opposite directions acting on an obj
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!