1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zigmanuir [339]
4 years ago
9

Which gas law refers to the solubility of a gas changing with the pressure over the solution

Chemistry
1 answer:
Dmitry [639]4 years ago
6 0

Answer:

the answer should be henry's law

You might be interested in
An ideal gas is a gas. <br> Perfect<br> Theoretical<br> Real
dusya [7]

Answer:

An ideal gas is a theoretical gas composed of many randomly moving point particles that are not subject to interparticle interactions. The ideal gas concept is useful because it obeys the ideal gas law, a simplified equation of state, and is amenable to analysis under statistical mechanics.

5 0
3 years ago
Read 2 more answers
How is the oxidation state of a transition metal determined from the chemical formula ?
Vera_Pavlovna [14]

Answer:

Explanation:

In a chemical formula, the oxidation state of transition metals can be determined by establishing the relationships between the electrons gained and that which is lost by an atom.

We know that for compounds to be formed, atoms would either lose, gain or share electrons between one another.

The oxidation state is usually expressed using the oxidation number and it is a formal charge assigned to an atom which is present in a molecule or ion.

To ascertain the oxidation state, we have to comply with some rules:

  • The algebraic sum of all oxidation numbers of an atom in a neutral compound is zero.
  • The algebraic sum of all the oxidation numbers of all atoms in an ion containing more than one kind of atom is equal to  the charge on the ion.

For example, let us find the oxidation state of Cr in Cr₂O₇²⁻

This would be:  2x + 7(-2) = -2

                          x = +6

We see that the oxidation number of Cr, a transition metal in the given ion is +6.

7 0
3 years ago
Read 2 more answers
I have five less protons than the least massive metalloid in<br> the fourth period. Who am I?
exis [7]

Answer:

You are the Cobalt

Explanation:

The least massive metalloid in the fourth period is Germanium, and it have 32 protons. If you have 5 less protons: 32 - 5 = 27 protons. The element with 27 protons is Cobalt

6 0
3 years ago
A molecule whose ends have opposite electric charge is call a_?
snow_lady [41]
A polar molecule is a molecule whose ends have opposite electric charges. An example of a polar molecule is H2O or water. Water has 1 side which is positive and the other side which is negative. It is a dipole which means that the two sides are not having the same charges.
5 0
3 years ago
Radiation refers to energetic waves and particles emitted by a radioactive source. Which of the following electromagnetic waves
ladessa [460]
Answer: Radio waves has the lowest energy and longest wavelength.
6 0
3 years ago
Other questions:
  • How do you solve for the Atomic Mass in chemistry?
    7·2 answers
  • If 200. g of water at 20°C absorbs 41 840 J of energy, what will its final temperature be? (Specific Heat of water is 4.184 J/g*
    15·1 answer
  • The ease with which a raw material can be molded , flattened , or bent is known as its ?
    15·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • The density of water is 1.00 g/cm3. The density of ice is 0.92 g/cm3. By what percent is the volume increased when water is froz
    8·2 answers
  • How many grams of glucose (C6H12O6) can be formed from 22 grams of CO2?
    10·1 answer
  • In the picture above, which numbered component would be the generator? (Choose the correct number)
    11·1 answer
  • Which person below is moving the fastest?<br> D<br> A<br> B<br> distance<br> time
    13·1 answer
  • A 7.0 L sample of gas begins at 2.5 atm and 320. K. What is the new pressure if the temperature is changed to 273 K and the volu
    5·1 answer
  • All of the following are reasons why equations or balanced EXCEPT
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!