1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Serjik [45]
2 years ago
13

What is the main priority of justice reinvestment?

Law
1 answer:
fgiga [73]2 years ago
7 0

Answer:

C) Prioritizing the use of alternatives to incarceration for nonviolent offenders

Explanation:

www.ncsl.org: "Justice Reinvestment is a process used by a growing number of states to curb corrections costs, reduce offender recidivism and maintain public safety. The data-driven reforms have been bipartisan, cross-governmental and impactful."

Hope this helps :)

You might be interested in
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
2 years ago
Which situation best illustrates the economic concept of opportunity cost?
kati45 [8]

Answer:

B. A business gives its employees a raise, so it cannot afford to buy any TV ads.

Explanation:

Opportunity cost also known as the alternative forgone, can be defined as the value, profit or benefits given up by an individual or organization in order to choose or acquire something deemed significant at the time.

Simply stated, it is the cost of not enjoying the benefits, profits or value associated with the alternative forgone or best alternative choice available.

For instance, if you decide to invest resources such as money in a paying your employees (workers), your opportunity cost would be the benefits like increased sales you could have earned if you had invested the same amount of resources in advertising your business.

Hence, the situation which best illustrates the economic concept of opportunity is when, a business gives its employees a raise, so it cannot afford to buy any TV ads.

7 0
3 years ago
What do you feel causes the most conflict? How can conflict be avoided in the first place?
nlexa [21]

Answer:

Cause 4: Goals. Goals are often the reason for conflict. The problem with goals is that we often do not articulate our goals out of fear. We fear that if we show our cards, we might not get what we want. When in conflict, it is probably true that everyone has a different goal in mind for the outcome of the conflict.

Explanation:

Can i have brainliest i've never got one have gave a llllloooooottttttt of theme but never got one

7 0
2 years ago
Moe allegedly breached his contract with Mary through nonperformance. Under state law, Mary is required to sue Moe within three
Alenkasestr [34]

Answer:

Statue of Limiatons

Explanation:

It makes it so that

4 0
2 years ago
Do maryland officers have to let victims know their rights
zubka84 [21]

Answer:

No. The police have no obligation to read you Miranda Rights just because they have arrested you. Further, a failure to read you Miranda Warnings does not make the arrest improper.

Explanation:

Hope this helps :)

5 0
2 years ago
Other questions:
  • Someone help me please!<br> Government
    14·1 answer
  • 4. When someone is hurt in an altercation and one party sues the other for repayment of their
    7·1 answer
  • What are the recent trends in American juvenile justice, and how has this portion of the American criminal justice system improv
    7·1 answer
  • How do corporations engage EPA when they are putting laws into regulations
    5·1 answer
  • Which of the following is an acceptable kind of car insurance?
    11·2 answers
  • Using your z-score table, find P(z &lt; 1.89)
    15·1 answer
  • Use the provided table to list five protected international human rights from the Universal Declaration of Human Rights. Include
    5·1 answer
  • What are two specific standards involving facility cleanliness which are checked during a health inspection?.
    5·1 answer
  • While driving, you see this pavement marking painted on the road ahead, in your lane. This
    7·2 answers
  • How to conduct a disciplinary hearing
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!