1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mixer [17]
3 years ago
9

Help me with this question so I can move on from it.

Chemistry
1 answer:
fomenos3 years ago
7 0

Just look it up on google kodvjkngkrefsnjkvjfrnefsjkj

You might be interested in
What is the specific heat for the steel wire
olganol [36]
I think that the answer is 0.49
8 0
3 years ago
How many grams of NaoH are needed to nutralize 50 grams of H2SO4?​
sergij07 [2.7K]

to neutralize 1 mole of H2 S o4 we need one mole of any if we are having 50 grams of H2 S o4 it means the mole of H2 S o4 in 50 gram will be 50×40)/98 hence

utilising 50 grams of H2 S o4 we need approximately 20. 5 gm of Naoh

6 0
3 years ago
Which condition is indicated by nervous tension, mood swings, headaches, bloating, and irritability?
butalik [34]
The best and most correct answer among the choices provided by your question is the third choice or letter C.

Premenstrual syndrome<span> (</span>PMS<span>) has a wide variety of </span>symptoms, including mood swings, tender breasts, food cravings, fatigue, irritability and depression. It's estimated that as many as 3 of every 4 menstruating women have experienced some form of premenstrual syndrome<span>. </span>Symptoms<span> tend to recur in a predictable pattern.</span>


I hope my answer has come to your help. Thank you for posting your question here in Brainly. We hope to answer more of your questions and inquiries soon. Have a nice day ahead!
4 0
3 years ago
For her science project, Paula wants to determine if the growth of bacteria in standing rainwater changes over time. She collect
tamaranim1 [39]

Answer:

The correct answer is - the number of days the rainwater stands in the jars.

Explanation:

The independent variable or the manipulating variable is a variable in a research or study is the variable which affects the dependent variable or the variable that is going to measure in the study.

In the study, variables that recieves the treatment and changed in every subject are independent variables and in this study number of days the rainwater standing in various jars that might affect the growth of the bacteria in rainwater.

8 0
3 years ago
Write the names of the following covalent compounds: no2
Nuetrik [128]

Answer:

nitrogen dioxide

Explanation:

this was on my chemistry test

7 0
3 years ago
Other questions:
  • Identify the correct statements associated with titration.
    5·1 answer
  • a gas has an intial volume of 2.75L at a temperature of 285K. if the temperature changes to 380K, what is the new volume of the
    12·1 answer
  • Which molecule listed below is a nonpolar molecule?
    12·1 answer
  • Brass is a solid solution composed of zinc and copper. Brass is classified as a (n): A.colloid B.suspension C.solution D.alloy
    12·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • What could happen to the amount of greenhouse gases in the atmosphere if oceans continue to warm? How could this impact global c
    14·1 answer
  • Oil floats on the surface of water but mercury sinks. why?​
    8·1 answer
  • GIVE ME ANSWERS
    9·2 answers
  • State two methods to increase the rate of the chemical reaction and explain
    13·1 answer
  • Question 3
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!