1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Studentka2010 [4]
3 years ago
9

what is the difference between the number of electrons in an atom of selenium, Se and the number of electrons in an atom of alum

inum, Al?
Chemistry
1 answer:
ELEN [110]3 years ago
5 0

Answer:

Well, electrons can be converted into a atomic number so if SE atomic number is 34 that means it has 34 electrons. AI has a atomic number of 13 meaning it has 13 electrons. So the difference is that SE has more electrons then AI.

You might be interested in
How does a scientist explain something when a controlled experiment cannot be carried out
Romashka [77]
<span> We look for evidence. There are numerous natural phenomenon that we can't observe happening in real-time because they happen over large time scales, or large spatial scales. But we can observe the effects of these phenomenon and make predictions about what other effects we should see. </span>
7 0
3 years ago
Select the compounds from the list below which are insoluble in water
natulia [17]

Answer:

Insoluble in water:

  • BaSO4
  • PbCl2
  • Cu2O
  • AgBr

Explanation:

Water turns out to be a good solvent for ionic substances, or in general, polarized covalent substances. On the other hand, it is not a good solvent for non-polar substances, these being the vast majority of covalent substances.

5 0
3 years ago
1. Which statement describes the properties of both elements that have just one valence electron and elements that have seven va
FromTheMoon [43]
Q1. They are highly reactive. Q2. High reactivity, nonmetallic. Q3. Oxygen has an ion charge of -2. Q4. LiCl I believe. Q5. How electrons are shared. Q6 1. Q7. Share 2 valence electrons, I believe.
3 0
3 years ago
Read 2 more answers
CO2<br> +<br> NaOH<br> &lt;=&gt;<br> NaHCO3<br> Balance
NeTakaya

Answer:

Explanation:

It is balaned

Left side

1 Na

1 C

3 Os

1 H

=========

Right side

1 Na

1 H

1 C

3 Os

5 0
3 years ago
Read 2 more answers
If you subtract an objects starting velocity from its final velocity and divide by the time it took to change velocity, what are
amid [387]
Change in velocity over time is acceleration. 

You're finding acceleration . 
7 0
3 years ago
Other questions:
  • How does the state of atoms in a neon light change when light is emitted?
    13·2 answers
  • Which term names the group of organisms able to interbreed and produce fertile offspring?
    10·1 answer
  • Which equation shows the beta decay of a transuranium element
    9·1 answer
  • A ____________ is a physical combination of things that can be separated. mixture compound
    8·1 answer
  • Heat is transferred at a rate of 2 kW from a hot reservoir at 775 K to a cold reservoir at 300 K. Calculate the rate at which th
    9·1 answer
  • What are abiotic factors HELP FAST PLEASE!!!!!!!!! FIRST ONE GIVEN BRAINLIEST AND 50 POINTS
    15·2 answers
  • When is a scientific theory formed?
    15·1 answer
  • Which of the following describes an energy transformation from chemical to electrical to light energy?
    12·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Fluids used for an intravenous transfusion must be ________ with bodily fluids. group of answer choices isosmotic hyperosmotic h
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!