1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
geniusboy [140]
3 years ago
9

Suppose 40.8g of copper(II) acetate is dissolved in 200.mL of a 0.70 M aqueous solution of sodium chromate.

Chemistry
1 answer:
Contact [7]3 years ago
4 0

Answer:

0.42 M

Explanation:

The reaction that takes place is:

  • Cu(CH₃COO)₂ + Na₂CrO₄ → Cu(CrO₄) + 2Na(CH₃COO)

First we <u>calculate the moles of Na₂CrO₄</u>, using the <em>given volume and concentration</em>:

(200 mL = 0.200L)

  • 0.70 M * 0.200 L = 0.14 moles Na₂CrO₄

Now we <u>calculate the moles of Cu(CH₃COO)₂</u>, using its <em>molar mass</em>:

  • 40.8 g ÷ 181.63 g/mol = 0.224 mol Cu(CH₃COO)₂

Because the molar ratio of Cu(CH₃COO)₂ and Na₂CrO₄ is 1:1, we can directly <u>substract the reacting moles of Na₂CrO₄ from the added moles of Cu(CH₃COO)₂</u>:

  • 0.224 mol - 0.14 mol = 0.085 mol

Finally we <u>calculate the resulting molarity</u> of Cu⁺², from the <em>excess </em>cations remaining:

  • 0.085 mol / 0.200 L = 0.42 M

You might be interested in
When collecting your solid, why should the filter paper in the Buchner funnel be wetted with some of the cold recrystallization
Mnenie [13.5K]

Answer:   It is important to wet the filter paper in the Buchner funnel first with cold re crystallization solvent before the re crystallization mixture being filtered to minimize gaps around the edges of the filter paper which can prevent mechanical impurities from passing through. This gives better filtration where most impurities can be filtered. Furthermore, it provides good vacuum.

6 0
3 years ago
If my aunt means degree Celsius or degrees Fahrenheit
JulijaS [17]
If it is 60 Celsius that would conver to fare height by means of this equation; (1.8*60)+32°F
Which would come out to.... 140° Fahrenheit... Hardly seems like chilly conditions.
7 0
3 years ago
Animal fibres are made up of​
zalisa [80]
Animal fibers are fibers from animals and consist mainly of protein. They contain not only silk fiber from silkworms and fur fiber from sheep wool but also collagen fiber extracted from animal skins, chitin from crustaceans, and shellfish like shrimp and chitosan made by deacetylating chitin.
6 0
3 years ago
Read 2 more answers
How much heat is required to raise the temperature of 50.0g of water 13°C<br>​
N76 [4]

Answer:one gram by 1oC

Explanation: you will need to know the value of water's specific heat

3 0
3 years ago
0.01040 m as an integer
SpyIntel [72]

Answer:

Here,

0.01040 m as an integer= 1.04 × 10-2

5 0
2 years ago
Other questions:
  • Classify blood as a mixture or a pure substance. if blood is a mixture, classify it as either heterogeneous or homogeneous. if b
    6·1 answer
  • Which of the following would contain 48 electrons?
    12·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • How many moles of water are made from complete reaction of 1.4 moles of hydrogen gas? Given the reaction: 2H2 + O2 → 2H2O
    8·1 answer
  • A chemist designs a galvanic cell that uses these two half-reactions: half-reaction standard reduction potential (s)(aq)(aq)(l)
    8·1 answer
  • An object measures 6.2cm x 13.7cm x 26.9cm. Which value is the length of the object?
    13·1 answer
  • Please help with this chemistry problem! thank you
    6·1 answer
  • How many atoms are there in 2.43 g of calcium?
    14·1 answer
  • What is the specific heat capacity of an unknown metal if 75.00 g of the metal absorbs 418.6J of heat and the temperature rises
    8·1 answer
  • Chlorobenzene, C6H5Cl, is used in the production of many important chemicals, such as aspirin, dyes, and disinfectants. One indu
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!