1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IRINA_888 [86]
3 years ago
7

Please help me ........

Chemistry
1 answer:
Eddi Din [679]3 years ago
3 0
H, i’m not entirely sure but from what i know about land and plates and how they work, h is the best answer
You might be interested in
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
Which of these is a chemical property?
Katyanochek1 [597]
Yes, refer to the previous answer.
6 0
3 years ago
Read 2 more answers
A 1.42-g sample of a pure compound with formula m2so4 was dissolved in water and treated with an ex- cess of aqueous calcium chl
solong [7]

The reaction between m_{2}SO_{4} with calcium chloride can be shown as-m_{2}SO_{4}+CaCl_{2}→CaSO_{4}↓+2mCl. The molecular weight of CaSO_{4} is 136.14g. The weight of sulfate ion is 96.06g. The molecular weight of m_{2}SO_{4} = (2×m + 96.06). From the reaction we can see that 1 mole of calcium chloride reacts with 1 molesm_{2}SO_{4} to produce 1 mole of calcium sulfate. Now 1.36g of calcium sulfate is equivalent to 1.36/136.14=9.989×10^{-3} moles of calcium sulfate.

Thus, 9.989×10^{-3} moles of m_{2}SO_{4} reacts in this reaction.

Let assume the atomic mass of m is x thus the molecular weight of m_{2}SO_{4} is 2x+96.

So we may write 9.989×10^{-3}× (2x+96) =1.42

Or, 2x + 96 = 142.146

Or, 2x = 46.146

Or, x = 23.073

Thus the atomic mass of m is 23.073. The atom (m) is sodium (Na).  

8 0
3 years ago
Which of the following is a characteristic of a scientific theory
Andru [333]

Answer:

number one

Explanation:

hope I helped

8 0
3 years ago
Which of the following is a true statement about the water cycle?
Serggg [28]
I think its C: due to mixing and oceanic.....
3 0
3 years ago
Other questions:
  • Which process transfers heat when particles collide in a solid
    6·1 answer
  • The radius of an atom of gold (Au) is about 1.35 Å. How many gold atoms would have to be lined up to span 5.0 mm ?
    13·2 answers
  • Green plants use light from the sun to drive photosynthesis, a chemical reaction in which liquid water and carbon dioxide gas fo
    6·1 answer
  • Liquid n-pentane and liquid n-octane are mixed to form a stream flowing at a rate of 1,496.5 lbm/hr. An in-line density measurem
    9·1 answer
  • Uhu khanay sai kia hota hai
    9·1 answer
  • What is a solvent using your own words
    14·2 answers
  • Guys the semester is about to end and i still got so much hw to do plaease help.
    14·1 answer
  • Which two statements are true about redox reactions?
    8·2 answers
  • NEED HELP FAST !! Does anyone know what element this is ??
    14·1 answer
  • Need help ASAP!!!!!!
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!