1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dem82 [27]
3 years ago
8

Which of the following compounds has a lower boiling point? Li2O H₂O KCI MgCl2

Chemistry
1 answer:
Kamila [148]3 years ago
6 0
Pretty sure it’s H2O
You might be interested in
What is the mass of 2 moles of nitrogen gas, N2?
drek231 [11]

Answer:

28g

Solution. Hence, 2 moles of nitrogen atoms weigh 28g.

6 0
3 years ago
What is the concentration of a saturated solution of SrSO4? SrSO4 has a Ksp of 3.2 x 10–7
Andrej [43]
SrSo4 = Sr(2+) + SO4(2-)

Let’s say that the initial concentration of SrSo4 was 1. ( or we have 1 mole of this reagent).

When The reaction occurs part of SrSo4is dissociated. And we get X mole Sr(2+) and So4(2-).
Ksp=[Sr(2+)]*[SO4(2-)]
X^2=3.2*10^-7
X=5.6*10^-4
5 0
3 years ago
help me on the bottom pleaseeeeeeee also please check the top BUT I NEED HELP OM THE BOTTOM TAJNKSKSKSLSLSLALS GOOODD BLESSS UUU
Yanka [14]
Because when you take the sand out it doesn't stay the same shape
3 0
3 years ago
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
3 years ago
What is the correct chemical equation for the reaction between methane and oxygen to produce carbon dioxide and water?
kodGreya [7K]

Answer:

The answer to your question is:   CH₄     +    3/2 O₂     ⇒     CO₂    +   2 H₂O

Explanation:

Methane = CH₄

Oxygen = O

Carbon dioxide = CO₂

Water = H₂O

                      CH₄     +    3/2 O₂     ⇒     CO₂    +   2 H₂O

        This is the balanced equation

                 

3 0
3 years ago
Other questions:
  • If a solution of potassium hydroxide is mixed with sulfuric acid, which type of reaction will most likely occur?
    7·2 answers
  • This substance should never be used to put out a petrol or oil fire
    15·1 answer
  • Eating of candy is a chemical change? How
    8·1 answer
  • What is the resulting pressure when you transfer gas from cylinder with a temperature of 22°C and the pressure of four atm into
    12·1 answer
  • Which object reflects light with with the longest wave
    5·1 answer
  • Calculate the value of a gold bar if it weighs 70lbs
    5·1 answer
  • Sodium reacts with water to produce sodium hydroxide and hydrogen gas:
    12·1 answer
  • Can colloidal suspensions be separated out by filtration
    11·2 answers
  • When sugar is burned, water vapor and carbon dioxide are produced.
    11·1 answer
  • Laticia draws the diagram below to show Earth’s magnetic field.
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!