1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
r-ruslan [8.4K]
3 years ago
5

Formula for Tricarbon heptabromide.

Chemistry
1 answer:
DiKsa [7]3 years ago
7 0
I believe it would be Au^4Cl8
You might be interested in
**Help!! **<br> How do I do this question
swat32
The answer is D. Okay l hope this helps
5 0
3 years ago
A heterogeneous mixture is a :
4vir4ik [10]
The correct answer is letter <span>C. mixture in which its components retain their identity. A heterogeneous mixture is a mixtures in which the component of the mixed are not uniform. You can see that there are localized regions that have different properties. The components have the capacity to retain their identity.</span>
8 0
3 years ago
Read 2 more answers
16 meters per hour to miles per sec
ss7ja [257]

Answer:

2.76 (full answer) 2.7617e-6

Explanation:

6 0
2 years ago
A chemist measures the amount of hydrogen gas produced during an experiment. She finds that 264. g of hydrogen gas is produced.
Lesechka [4]

Answer:

The answer is 130.953 g of hydrogen gas.

Explanation:

Hydrogen gas is formed by two atoms of hydrogen (H), so its molecular formula is H₂. We can calculate is molecular weight as the product of the molar mass of H (1.008 g/mol):

Molecular weight H₂= molar mass of H x 2= 1.008 g/mol x 2= 2.01568 g

Finally, we obtain the number of mol of H₂ there is in the produced gas mass (264 g) by using the molecular weight as follows:

mass= 264 g x 1 mol H₂/2.01568 g= 130.9731703 g

The final mass rounded to 3 significant digits is 130.973 g

4 0
3 years ago
8. If a chemical reaction such as photosynthesis begins with 6 atoms of carbon (C), how many atoms of carbon (C) should be in th
NISA [10]

Answer

b

Explanation:

4 0
2 years ago
Other questions:
  • When you can not see what is taking place, but other senses indicate occurences. this is called?
    12·1 answer
  • A cylinder is submerged in water as illustrated in the diagram. If the area of the top and the bottom of the cylinder is the sam
    6·2 answers
  • What is it called when a rock is rusting
    8·1 answer
  • What is the molarity of 2 moles of iron oxide,FeO in 8 Liters of water
    9·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Weather ionic or covalent, what does bonding always involve?
    8·1 answer
  • A compound is found to contain 42.88 % carbon and 57.12 % oxygen by weight. To answer the questions, enter the elements in the o
    6·1 answer
  • Lice are parasitic insects that live on the scalp, eyebrows, and eyelashes of humans
    11·1 answer
  • Describe one way that grazing animals, such as bison or cattle, help to maintain grassland ecosystems.
    14·1 answer
  • Which vein carries oxygenated blood back into the heart?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!