1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Svet_ta [14]
2 years ago
13

Which of these reservoirs contains the most water?

Chemistry
1 answer:
Mumz [18]2 years ago
3 0

Answer:

Glaciers

Explanation:

Reservoirs refers to paces where water are stored. The largest water reservoir on earth are the oceans which contain about 97% of all the water on the earth.

The next highest  reservoir  are the glaciers or the polar ice caps. These hold quite an enormous amount of the water found on earth.

Surface and other fresh water only account for about 1.2% of all the surface water on earth.Ground water accounts for a very minute percentage of the water found on earth.

You might be interested in
In a physical change of matter,​
mel-nik [20]

Answer: C. no new substances are formed<span>
</span><span>
<span>In the physical change of matter, there is no new substance that is formed. It is only the appearance of the matter that is being changed and not its chemical composition. Cutting, tearing and grinding are only some of the examples that exhibit physical change. </span></span>

5 0
3 years ago
Read 2 more answers
What is the name of the process during which a bond between two monomers is broken?
Snezhnost [94]

Answer: D, hydrolysis

Hydrolysis is any chemical reaction in which a molecule of water ruptures one or more chemical bonds. The term is used broadly for substitution, elimination, and fragmentation reactions in which water is the nucleophile.

8 0
3 years ago
Write a balanced equation formed when the following elements react with oxygen:a)Zinc
Ainat [17]

Explanation:

a) when zinc burnt in oxygen.

2Zn + O2 -----∆-----> 2ZnO(black residue)

b) when carbon burnt in oxygen.

C+O2----∆---> CO2.

c) when sulphur burnt in oxygen.

S+O2-----∆-----> SO2.

d) when Calcium burnt in oxygen.

2Ca+O2-----∆-----> 2CaO(black residue)

e) when Magnesium burnt in oxygen.

2Mg+O2-----∆----> 2MgO.

f) when sodium burnt in oxygen.

4Na+O2----∆-----> 2Na2O.

hope all these reactions help you.

4 0
3 years ago
If the density of an object is 5 g/cm3 and it takes up 7 cm3 of space, calculate the mass?
statuscvo [17]

Answer:

<h2>The answer is option A</h2>

Explanation:

The mass of a substance when given the density and volume can be found by using the formula

<h3>mass = Density × volume</h3>

From the question

volume of object = 7 cm³

density = 5 g/cm³

The mass of the object is

mass = 5 × 7

We have the final answer as

<h2>35 g</h2>

Hope this helps you

8 0
3 years ago
F
kobusy [5.1K]

Answer:

From the periodic table, Atomic number of fluorine is 7 and atomic mass is 19

8 0
2 years ago
Other questions:
  • Help me please someone?
    15·1 answer
  • What CPT code is reported for a percutaneous needle biopsy of mediastinum?
    13·2 answers
  • a dog is trained to sit and shake hands. These traits are most likely? a. inherited b. not inherited c. not acquired d. innate
    15·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • The colour of RBC is Red .why?​
    9·1 answer
  • I<br> n a mole there are 602
    12·1 answer
  • Which describes the greatest difference between gases and solids?
    13·2 answers
  • Does anyone have the student exploration sheet answers for the Drug Dosage (Forensic Science) Gizmos lab?​
    6·1 answer
  • Need help asap thanks
    11·2 answers
  • 1 Which of the following is an example of periodicity?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!