1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
german
3 years ago
8

Strong bases are good conductors of:

Chemistry
2 answers:
Zepler [3.9K]3 years ago
8 0

Answer:

B. Electricity

Explanation:

Karolina [17]3 years ago
7 0

Answer:

Electricity

Explanation:

Answer to founders education

You might be interested in
50 examples word equation with balanced chemical equarion​
gulaghasi [49]
This question may only be ansewered by frequent mattrrs
5 0
1 year ago
When one form of energy is converted to another form in any physical or chemical change, energy input alwasy equals energy outpu
aliya0001 [1]
In the context of chemistry, yes. Energy input is always equal to the energy output.
5 0
3 years ago
1. Which of the following best describes the relationship
Ipatiy [6.2K]
D there is one kind of cell of which all living things are made
8 0
3 years ago
Be + O2 --&gt; BeO<br><br> Balance this and what's the type of reaction?
max2010maxim [7]

Answer:

2Be + O2 = 2BeO

its a synthesis

Explanation:

7 0
2 years ago
Predict how many grams of KCI is produced from 40 grams of K?
Nutka1998 [239]

Explanation:

firstly find for the molar mass of kcl and molar mass of k

and then

molar mass of k = x

molar mass of kcl= 40

cross mutiply and then simplify you will get your answer

5 0
3 years ago
Other questions:
  • What is the mass, in grams, of 6.11 mol of sulfur trioxide?
    13·2 answers
  • In an undisturbed stack of rock layers, each containing fossils of once-living organisms, where would some evidence of the most
    5·2 answers
  • 5. Tree sap can be a very concentrated solution of solutes in water. These are mostly sugars, with van’t Hoff factors of 1. The
    12·1 answer
  • Products in which titanium is used?
    15·1 answer
  • Specify which atoms, if any, bear a formal charge in the Lewis structure given and the net charge for the species. Be sure to an
    13·1 answer
  • In what era did dinasours first appear?
    13·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • How does freezing and evaporation affect salinity? Choose ALL that apply Lesson 2.05 When that water melts in the spring, the sa
    12·1 answer
  • What were the first 5 planets that were observed? Why were those the only ones? Help pls!
    10·1 answer
  • How many moles of oxygen are needed for the complete combustion of 12.6 moles of acetylene?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!