1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
user100 [1]
3 years ago
7

What biological molecules provide energy and structural support to living organisms?

Chemistry
1 answer:
Romashka [77]3 years ago
3 0

Answer:

Option D: Carbohydrates

Explanation:

Carbohydrates are a group of macromolecules that are a vital energy source for the cell, provide structural support to many organisms, and can be found on the surface of the cell as receptors or for cell recognition.

You might be interested in
1- Which process are fast in carbon cycle?
g100num [7]

Answer:

During photosynthesis, plants absorb carbon dioxide and sunlight to create fuel—glucose and other sugars—for building plant structures. This process forms the foundation of the fast (biological) carbon cycle.

The Slow Carbon Cycle. ... Atmospheric carbon combines with water to form a weak acid—carbonic acid—that falls to the surface in rain. The acid dissolves rocks—a process called chemical weathering—and releases calcium, magnesium, potassium, or sodium ions.

6 0
3 years ago
6. _______ is a neutral solution. A. Blood B. Salt water C. Pure water D. Milk E. All of the Above
FinnZ [79.3K]

The answer is option E. All of the above

4 0
3 years ago
How many grams are 1.25 moles of potassium bromide (KBr)?
sukhopar [10]

Answer:

The SI base unit for amount of substance is the mole. one mole is equal to one mole potassium bromide or 119.0023 grams

6 0
3 years ago
What is the ratio of Fe ions to O ions in a neutral compound?
AVprozaik [17]
1:1

Fe has a charge of 2+ while O has a charge of 2-.

Formula: FeO
3 0
3 years ago
Read 2 more answers
A rock's mass is a:
Alekssandra [29.7K]

Answer:

all of the above

Explanation:

now I will bless you with this-

7 0
2 years ago
Other questions:
  • Why is an energy source needed in order to have a working electric circuit
    12·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • What is other word for carefully looking at an object or process beginning with the letter O and is 11 letters long
    15·1 answer
  • Which layer of the earth is the thinnest and thickest?
    15·1 answer
  • How can you help your muscles stay healthy?<br> No links, If right I will mark Brainliest.
    6·2 answers
  • What is the mass of 2.542 × 1026 atoms of F?
    11·1 answer
  • Two factors that determine kinetic energy are
    8·2 answers
  • Hello..................<br><br>.....​
    9·1 answer
  • Which wave characteristic determines color
    13·2 answers
  • What is the identity of a metal that has a mass of 27.0 g and a volume of 10.0 cm3?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!