1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
konstantin123 [22]
3 years ago
8

Whats the volume of 0.522 moles of carbine dioxide

Chemistry
1 answer:
jasenka [17]3 years ago
4 0
As discussed in Raymond Chang’s introductory textbook “Chemistry,” a mole is a measure of molecules, equal to approximately 6.022x10^23 molecules, where the caret ^ refers to exponentiation. Using the ideal gas formula, you can find the number of moles of carbon dioxide (CO2) in a container if you know the other needed parameters and conditions. Above 150 pounds per square inch (PSI), or around 10 times normal atmospheric pressure, the ideal gas formula starts losing accuracy and the Van der Waals formula becomes increasingly preferable.
You might be interested in
Why doesn't the earth,s shadow get cast onto the moon every month ?
soldi70 [24.7K]
Becuz the sun refelt off the earth and on to the moon.

8 0
3 years ago
Chemist question, helppp pls
Doss [256]

1: it is +2

2: it is +6

(Make this brainliest answer please)

8 0
2 years ago
Where the values come from?
Scrat [10]

Answer:

To find the average atomic mass, you take a certain number of atoms, find the total mass of each isotope, and then divide the total mass of all the atoms by the total number of atoms. Assume that you have, say, 10 000 atoms of carbon

Explanation:

5 0
3 years ago
How many moles are in 155 grams of aluminum
Aliun [14]

Answer:

wads

Explanation:

wadsdw

8 0
3 years ago
Use the Earth's Energy Budget diagram to answer the question. Based on the diagram, less solar energy that reaches Earth is ____
Ivan
<span>absorbed, radiated
Hope this helps. </span>
5 0
3 years ago
Other questions:
  • A student visits the beach during a very hot day. She steps on the sand and jumps because it is so hot. What type of heat transf
    10·2 answers
  • Two objects are dropped into beaker with layers of oil, rubbing alcohol, water and corn syrup. These objects are made of the sam
    5·1 answer
  • What type of bond allows sugars to polymerize?
    11·1 answer
  • For heat transfer purposes, a standing man can be modeled as a 30-cm-diameter, 175-cm-long vertical cylinder with both the top a
    13·1 answer
  • Which is a nonpolar molecule?
    12·2 answers
  • How many moles of each substance are needed to prepare the following solutions?
    12·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • The speed of a motorcycle increases from 10 kilometers per hour to 50 kilometers per hour in 9 seconds. What is its acceleration
    12·1 answer
  • a substance did not change its chemical nature in a reaction. which most likely describes the reaction
    7·2 answers
  • While watching tv in your room one nigh, you decide to have some Oreos and a glass of milk. there were only 3 Oreos and science
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!