1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex787 [66]
2 years ago
9

2. How many moles are there in 20 grams of Carbon?

Chemistry
1 answer:
faust18 [17]2 years ago
3 0

Answer:

1.6666666666666 is the ans bcz in each mole there r 12 grams of carbon so the ans is goingtobe 20÷12

You might be interested in
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
There are some cells that do not have DNA. <br> O True<br> O false
raketka [301]

Answer:

false

Explanation:

8 0
2 years ago
Read 2 more answers
4. Which of the following have mass? Select all that apply.
valkas [14]
All of these EXCEPT helium in a balloon
4 0
3 years ago
Why is ginger used in food preservation
Vaselesa [24]
Spices like ginger are significantly used in preservatives because they have antimicrobial properties in their chemical compounds. They also have antioxidant properties that allow food to be preserved.
6 0
3 years ago
A standard solution is prepared for the analysis of fluoxymesterone (c20h29fo3; 336 g/mol), an anabolic steroid. a stock solutio
-Dominant- [34]

<em>Answer:</em>

  • The concentration of new solution will be 1×10∧-7 M.

<em>Solution:</em>

<em>Data Given </em>

       given mass of fluoxymesterone =16.8mg = 0.0168 g

       molar mass  of fluoxymesterone = 336g/mol

       vol. of fluoxymesterone = 500.0 ml = 0.500 L

      Stock Molarity of  fluoxymesterone = (0.0168/336)÷0.500 = 1×10∧-4 M

So applying dilution formula

                   Stock Solution :  New Solution

                                 M1.V1 = M2.V2

       ( 1×10∧-4 M) × (1×10∧-6 L) = M2 × 0.001 L

     [( 1×10∧-4) × (1×10∧-6)]÷[0.001] = M2

     1 × 10∧-7 = M2

<em>Result:</em>

  • The concentration of new solution M2 will be  1 × 10∧-7
3 0
3 years ago
Other questions:
  • Max discovered a beaker full of transparent liquid in the science lab. He hypothesized that since the liquid is transparent like
    13·1 answer
  • An orbital would never exist in the quantum description of an atom is
    12·1 answer
  • Neon has 8 electrons in it's outer shell. Does it need to bond? Why or why not?
    13·1 answer
  • Please explain this to me work would be awesome thank you!
    15·1 answer
  • How does the atomic radius increase?
    8·1 answer
  • Which feature forms as a result of conduction between magma and water?
    6·2 answers
  • Send help thank u asap
    9·2 answers
  • The total number of sodium atoms in 46.0 grams of sodium<br> is
    13·1 answer
  • Which of the following represents an endothermic reaction?
    15·1 answer
  • What is the solubility of potassium chloride at 20 C?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!