1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex787 [66]
3 years ago
9

2. How many moles are there in 20 grams of Carbon?

Chemistry
1 answer:
faust18 [17]3 years ago
3 0

Answer:

1.6666666666666 is the ans bcz in each mole there r 12 grams of carbon so the ans is goingtobe 20÷12

You might be interested in
Organisms such as grass and lichens are classified as
mash [69]

I think the answer is producers

I hope that helped and have a nice day!! (:

3 0
3 years ago
Which of the following is not a type of fault?
bekas [8.4K]

normal is the answer


8 0
3 years ago
Complete these metric conversions: 53 m - mm*
EleoNora [17]

Answer:

53 meters = 53000 millimeters

Explanation:

In this question we have to convert meters into millimeters .

By metric conversion,

Since, 1 meter = 1000 mm

Therefore, 53 meters = 53 × 1000

                                  = 53000 millimeters

53 meters = 53000 millimeters is the answer.

3 0
3 years ago
Which term names the concentration of salts dissolved in a liquid?
Viefleur [7K]
Hey there!
The answer is D, Salinity.
Salinity is the concentration of salt in water. Ocean water often has high salinity and this can contribute to things like upwelling and water density- but these all start from salinity.
Hope this helps!
4 0
3 years ago
Read 2 more answers
What element is similar to Baruim
aivan3 [116]

Answer:

calcium ca

Explanation:

We can see here that the only element that is on the same group (column) as Ba (Barium) is Calcium (Ca).

3 0
3 years ago
Read 2 more answers
Other questions:
  • Draw the product formed when oleic acid is hydrogenated.
    12·1 answer
  • Which of the following ions is an oxyanion?
    15·2 answers
  • Media X contains 2mM glucose, 5% NaCl and 10mM beef extract. This is an example of a (COMPLEX/DEFINED) media.
    10·1 answer
  • By studying a star's spectrum, scientists can work out its chemical make-up and temperature. What instrument do astronomers' use
    6·2 answers
  • First to help me with these 4 gets brainless HURRYTTT UPPPPP
    10·2 answers
  • Arrange the following bonds in order of increasing ionic character:
    11·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • How today's pharmaceutical
    15·2 answers
  • 13500 mL convert to milliliters of mercury
    14·1 answer
  • What would the products of a double-replacement reaction between KBr and CaO be? (Remember: In double-replacement reactions, the
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!