1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pani-rosa [81]
3 years ago
6

Geologists apply various methods to study the layers of the earth. Which if the following is a method used to study the deaths l

ayers
Chemistry
1 answer:
timama [110]3 years ago
6 0

Answer: ???

Explanation:???

You might be interested in
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
Please help me with letter a question
yaroslaw [1]
Rise, increase, toward, away from

i think those are your answers if u want help figuring out where to put the arrows lmk
6 0
4 years ago
Energy is gained and lost in small units or amounts called
jarptica [38.1K]
It is A. Quanta, have a nice day!!
8 0
3 years ago
Absolute zero is what temperature on the fahrenheit scale?
vampirchik [111]

Answer:

  • Absolute zero is - 459.67 °F

Explanation:

<u>1) Convert absolute zero to celsius:</u>

  • 0 K = - 273.15°C ( this is per definition of the scale)

<u>2) Convert - 273.15°C to Fahrenheit:</u>

  • T (°F) = T (°C) × 1.8 + 32 (this is the conversion equation=

  • T (°F) = - 273.15 × 1.8 + 32 = - 459.67 °F ← answer

8 0
3 years ago
What is the element with 2 protons on the
Paul [167]

Answer:

Helium

Explanation:

7 0
3 years ago
Other questions:
  • What are found on the right side of the arrow in a chemical reaction
    7·1 answer
  • The recommended application for dicyclanil for an adult sheep is 65 mg/kg of body mass. If dicyclanil is supplied in a spray wit
    6·1 answer
  • We mix 0.08 moles of chloroacetic acid (ClCH2COOH) and 0.04 moles of
    7·1 answer
  • What is the name of the compound CO?\
    7·2 answers
  • What happens to the particles in a berry sauce mixture as it boils?
    8·1 answer
  • a cylinder container is filled with air. its radius is 6cm and its height is 3.5cm. what is the volume of the air inside?
    9·1 answer
  • Gets their food by braking dead material?
    6·1 answer
  • WILL MARK BRAINLIEST!!<br><br> What is the percent composition of each element in barium nitrate?
    14·1 answer
  • Which of the following is not true
    14·1 answer
  • Question 8 (3 points) What is the formula for Silver (III) sulfide? O Ag2(SO4)3 O Ag3(SO4)2 Ag3S2 Ag2S3​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!