1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ronch [10]
3 years ago
7

PLEASE PLEASE HELP ME!! I WILL BRAINLIST YOU!! A 28.0 g sample of N2 is in a rigid 4.50 L container at 32 °C. Calculate the pres

sure in the flask in torr.
Chemistry
1 answer:
chubhunter [2.5K]3 years ago
6 0

Answer:

P=4184.36 torr

Explanation:

For this problem we can use the idea gas law,

PV=nRT

where P is pressure, V is volume, n is moles of substance, R is the constant, and T is temperature, We will need to manipulate it and a couple values so that we can get our answer in torr. To do this, let's rearrange the equation to solve for P.

P=\frac{nRT}{V}

Next, let's convert T (32) to kelvin. To do this, add 273 to the value.

32+273=305

Next, let's convert 28g of N2 to moles of N2. To do this, divide 28 by the molar mass of N2 (28.02)

\frac{28.0}{28.01} \\=.99 moles of N2

Next, we need to find out what value of R we need to use. Because you want your answer in torr, we will need to use the value of

R=62.36\frac{torr}{mol*K}

Now that we have all of our values, let's plug them into the equation (I'll be excluding units for simplicity but they cancel out to leave units of torr in the answer)

P=\frac{(.99)(62.36)(305)}{4.50}\\P=4184.36

P=4184.36 torr

<em>Very briefly</em>, I don't know what your periodic table looks like, but mine has nitrogen's molar mass as 14.01. If you have a different mass of nitrogen, this pretty drastically impacts the value. For example, if your nitrogen's molar mass was rounded to 14.0 (making N2 28g) then it would be one mole instead of .99 moles, raising the answer to 4228.70 torr. If you have any different values just plug them in in their proper spots. A similar concept applies to the Kelvin conversion.

You might be interested in
What does the name iron(ii) in a compound indicate about the cation?
bija089 [108]

Answer:- Fe^+^2

Explanations:- Transition elements shows variable oxidation states. So, while naming these compounds we use the roman numerals to tell their oxidation states.

For example, if someone writes just Iron oxide then it would not be correct since Iron could be in +2 or +3 states. So, it might be Fe^+^2 or Fe^+^3 . So, the right was is to mention the oxidation state of the transition metal.

If the name is written as Iron(II) in a compound then it means there is +2 charge on iron and it is Fe^+^2.


5 0
3 years ago
Read 2 more answers
A hotdog is matter, but the heat that cooks it is?
Vlad [161]
The heat that cooks it, is matter as well.. 

Hope this helps :)
4 0
3 years ago
Moist Brown solid Solid J K Oxygen Add solid L Heat Add dilute Solid M Colourless nygas N Black Precipitate P Bubble through CuS
Lerok [7]

Answer:add solid l and k

Explanation:

6 0
2 years ago
Oxidation can be defined as_______ question 4 options: increase in oxidation number decrease in oxidation number gain of electro
KiRa [710]
If you combine zinc with apple juice it is toxic.

8 0
3 years ago
Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
inysia [295]

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

4 0
2 years ago
Other questions:
  • Ethene is converted to ethane by the reaction
    6·1 answer
  • When is glucose generated?!? HURRY PLEASE
    11·2 answers
  • In your own words, give two reasons why it is important to work with a partner while completing a lab.
    5·1 answer
  • An orange has a mass of 359 grams . How many kilograms is this?
    5·1 answer
  • Element "Z" has 2 naturally occurring isotopes with the following masses and natural abundances:
    13·1 answer
  • Has colored salts that will produce colored aqueous solutions
    11·1 answer
  • 2. What is the relationship between the scientific method and bias? Explain in detail.
    6·1 answer
  • Aluminum oxide is a covalent compound. True False
    12·2 answers
  • What is the specific heat of silicon if the temperature of a 4.11 g sample of silicon
    9·1 answer
  • Identify the element that cannot participate in nuclear fission reactions.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!