1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miss Akunina [59]
2 years ago
11

Which factor affects the amount of gravitational potential orgy at object but

Chemistry
2 answers:
zmey [24]2 years ago
7 0

Answer:

Speed

Explanation:

MrRissso [65]2 years ago
6 0

Answer:

mass

Explanation:

your welcome

You might be interested in
A rigid container is filled with chlorine gas. The gas has a pressure of 2.75 bar. The tank is then cooled down to -20.0oC at wh
Gnom [1K]

Answer:

Original temperature (T1) = - 37.16°C

Explanation:

Given:

Gas pressure (P1) = 2.75 bar

Temperature (T2) = - 20°C

Gas pressure (P2) = 1.48 bar

Find:

Original temperature (T1)

Computation:

Using Gay-Lussac's Law

⇒ P1 / T1 = P2 / T2

⇒ 2.75 / T1 = 1.48 / (-20)

⇒ T1 = (2.75)(-20) / 1.48

⇒ T1 = -55 / 1.48

⇒ T1 = - 37.16°C

Original temperature (T1) = - 37.16°C

3 0
3 years ago
A change in which property of light will have no effect on whether or not the photoelectric effect occurs?
lorasvet [3.4K]

Answer:

intensity

Explanation:

Intensity has no affect on whether or not the photoelectric effect occurs. The determining property is frequency and since frequency and wavelength are inversely proportional, wavelength matters as well

3 0
3 years ago
When an object is lifted 10 feet off the ground, it gains a certain amount of potential energy. If the same object is lifted 30
Elden [556K]

Answer: 3 times as much the potential energy

Explanation:

Potential energy is the energy possessed by an object by virtue of its position.

P.E=m\times g\times h

m= mass of object

g = acceleration due to gravity

h = height of an object  

When same object with same is lifted from 10 feet to 30 feet. The height has increased 3 times , thus the potential energy will also get 3 times as much.

4 0
3 years ago
Non-metal ions are negative because...
abruzzese [7]

Explanation:

its b cz the gain electrons i think

6 0
3 years ago
What kind of nuclear reaction would result in the release of a beta particle
lorasvet [3.4K]
Beta decay converts a neutron to a proton and emits a high-energy electron, producing a daughter nucleus with the same mass number as the parent and an atomic number that is higher by 1.
3 0
3 years ago
Other questions:
  • Which acid-base imbalance would be caused by overaccumulation of co2 in the blood?
    8·1 answer
  • Write a chemical equation for hcl(aq) showing how it is an acid or a base according to the arrhenius definition.
    15·1 answer
  • At what temperature is the substance a heated gas ?
    14·2 answers
  • What is an output force?
    13·2 answers
  • What part of Dalton’s atomic theory was later proved to be incorrect?
    9·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Type the correct answer in the box. Express your answer to three significant figures. An air mattress is filled with 16.5 moles
    11·1 answer
  • If an ion has 22 protons and 18 electrons, then what is its charge?
    15·2 answers
  • Question 1 of 30
    6·2 answers
  • Studying the decay of radioactive isotopes in dead organisms helps scientists to identify fossilized remains. The ratio of C-12
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!