1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viefleur [7K]
3 years ago
9

Would a block of mass of 32 g the leisure 3 cm in all directions float or sink in water

Chemistry
1 answer:
jolli1 [7]3 years ago
7 0
A body will float if its density is smaller than the density of water and will sink if its density is bigger than the density of water.

So, you need to calculate the density of the block.

Density = mass / volume

mass = 32 g

volumen = (3cm)^3 = 9 cm^3

=> density = 32 g / 9 cm^3 = 3.55 g/cm^3

Given that the density of water is 1.0 g /cm^3, the density of the block is greater and you conclude it will sink in water.

Answer: the block will sink in water

You might be interested in
Is cutting your nails a physical or chemical change
Temka [501]
Cutting of Nails is a Physical Change since no new substance is formed.
Don't confuse it with Reversible and Irreversible Changes
4 0
3 years ago
Read 2 more answers
What is haloalkanes? <br><img src="https://tex.z-dn.net/?f=%20%5C%5C%20" id="TexFormula1" title=" \\ " alt=" \\ " align="absmidd
expeople1 [14]

Answer:

It is a group of compound derived from alkanes containing one or more halogens .

7 0
3 years ago
Read 2 more answers
If a snack cake contains 450 food calories and Carla
Oksana_A [137]

Answer:

9/10hr

Explanation:

From the question given:

Carla was able to burn 250 calories by running for one-half (1/2)hr.

Therefore, Carla will burn 450calories by running for = (450x1/2) /250 = 225/250 = 9/10hr

8 0
3 years ago
What is a type of science that studies Earth and space
posledela
Geology and astronomy are two types of earth science. Geology is the study of rocks and minerals and astronomy is the study of space.
3 0
3 years ago
What is the basic unit of all matter? A. Neutron B. Atom C. Electron D. Proton E. Nucleus
charle [14.2K]

An atom is the basic unit of all matter. The other answers are just pieces of an atom

7 0
3 years ago
Read 2 more answers
Other questions:
  • Which elements properties form the basis for all life
    5·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • How did Bohr refine the model of the atom? How did Bohr refine the model of the atom? He developed electrochemistry. He discover
    8·1 answer
  • true or false: 1. An object can have only one type of energy at a time 2. If an object has energy, it must be moving. 3. All ene
    6·1 answer
  • A single covalent bond is made up of​
    9·1 answer
  • In order to prove that the Law of Conservation Mass is obeyed, what are the coefficients
    10·1 answer
  • Titration of 25.0 mL of an HCl solution of unknown concentration requires 14.8 mL of 0.100 M NaOH. What is the molar concentrati
    8·1 answer
  • The resulting net force of an object is represented below. →10 N Which most likely represent the forces acting on the object?
    5·1 answer
  • What particles would you find in a nucleus of an atom
    6·1 answer
  • How many moles of Hydrogen gas will be produced if you start with 2.5 moles of Magnesium and an excess of Hydrochloric Acid give
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!