1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arada [10]
3 years ago
9

What is the result of adding 2.5 × 10³ and 3.5 × 10²?

Chemistry
2 answers:
Elanso [62]3 years ago
7 0

Answer:

A

Explanation:

It is correct please I hope it helps! :)

Dvinal [7]3 years ago
6 0
Jdjdjfng jdjdjfng fifth djdkgh djdkfg VJCHGf 123
You might be interested in
What is the mass of NaCl required to make 140 grams of a 12% solution of NaCl in water?
Makovka662 [10]

Answer:

C. 17 grams.

Explanation:

∵ mass % = [mass of solute/mass of solution] x 100.

mass of solute (NaCl) = ??? g & mass of solution = 140.0 g.

<em>∴ mass of NaCl = (mass %)(mass of solution)/100 </em>= (12.0)(140.0)/100 = <em>16.80 g ≅ 17.0 g.</em>

3 0
3 years ago
Read 2 more answers
What are the products produced when an acid and base react together
SashulF [63]
Both products will start to cancel the acidity and how strong the base is if they are mixed. If the acid is stronger than the base then it will be an acidic product and visa versa if the base is stronger than the acid.
4 0
3 years ago
Read 2 more answers
Find mass of 3 moles of water​
EleoNora [17]

Answer:

54 g

Explanation:

1 mole of water = H2O

mass of 1 mole of H2O= mass of h2 + mass of o

= 2× mass of h +mass of o

= 2×1+16 =18 g

1 mole of water = 18g

3moles of water = 18×3g= 54g

6 0
3 years ago
What kind of sport do you have interest the most and explain why? <br>​
lidiya [134]

Answer

Gymnastics

Explanation:

for the simple fact that they do cool stuff

7 0
2 years ago
J.j thomson a british physicist was the first to identify the
Shalnov [3]
<span>J.j thomson a british physicist was the first to identify the electron in 1987</span>
5 0
3 years ago
Other questions:
  • How many grams of KCl are needed to prepare 1.00 L of a 2.00 M solution
    9·1 answer
  • The average mass of a kernel of popcorn is 0.125 g if one pound equals 16 oz, and 1 oz equals 28.3 g then how many kernels of po
    11·2 answers
  • Which of these is a compound? A. Steel B. Suger C. Air D. Nitrogen
    9·2 answers
  • Is milk or ice cream a more stable colloid
    12·1 answer
  • 4. Explain why 50 g of liquid water at 0°C heats-up more quickly than 50 g of an ice water mixture at 0°C under the same conditi
    13·1 answer
  • Please Help Me on this!!!! I'll Mark Brainliest!!!!! Thanks!!!!!!
    11·2 answers
  • What is the formula for potassium fluoride?
    5·1 answer
  • Plz help I’ll give brainliest!!!
    15·1 answer
  • Help me please!! thanks!
    15·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!