1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lana [24]
3 years ago
12

Which of the following is NOT an advantage of a wireless network? convenience reliability security speed

Chemistry
1 answer:
Len [333]3 years ago
3 0

Answer:

Security

Explanation:

A wireless network consists of good connection with fast speed, convenience, and reliability. Security is a major problem with wireless connection as someone can get your information by joining the same connection as you.

You might be interested in
Is bleach liquid starch? <br> Yes or No
Jobisdone [24]

Answer:

O it's not

Explanation:

Have a great day!

8 0
2 years ago
Which of the following statements is true?
miss Akunina [59]
C plasmas have a net negative charge
3 0
3 years ago
Read 2 more answers
Convey the following information in the form of balanced chemical equation:
Aliun [14]

Answer:

Carbon dioxide reacts with limewater (a solution of calcium hydroxide, Ca(OH) 2), to form a white precipitate (appears milky) of calcium carbonate, CaCO 3.

Hope it helps you! :)

6 0
2 years ago
Which element in the third period would you expect to have the larger atomic radius, sodium (Na) or Sulfur
miskamm [114]
Sodium will have a larger radius. Look up the atomic radius Trend
4 0
3 years ago
lucose, a major energy-yielding nutrient, is present in bacterial cells at a concentration of approximately 0.200 mM. i) What is
Mkey [24]

Answer:

The concentration is 0.036 mg/mL

Explanation:

Concentration = 0.2 mM = 0.2/1000 = 2×10^-4 M = 2×10^-4 mol/L × 180,000 mg/1 mol × 1 L/1000 mL = 0.036 mg/mL

3 0
2 years ago
Other questions:
  • platinum is used as a catalyst to break down harmful gases in car exhaust into less harmful gases. Which statement best describe
    14·1 answer
  • A small diamond, which is made of pure carbon, contains too many carbon atoms to count individually. Which is closest to the num
    11·1 answer
  • Imagine two solutions with the same concentration and the same boiling point, but one has benzene as the solvent and the other h
    13·1 answer
  • Give an example of oxidation reaction which can be a nuisance
    11·1 answer
  • Determine the concentration of a solution made by dissolving 1.40grams NaCL in enough water to make 30.0mL of solution.
    8·1 answer
  • 4. Calorimetry can be used to determine the specific heat capacity of different substances (not just metals). Using the online c
    10·1 answer
  • Use the graph to answer these questions. The total energy of the reactants is –3,811.92 kJ. –1,273.02 kJ. –2,538.90 kJ.
    12·2 answers
  • Consider an electrochemical decomposition apparatus comprised of a strontium chloride cell, a berylium chloride cell, and a bari
    10·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • given your proposed electron pushing mechanism, list as many factors that could play a role in the success or failure of the rea
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!