1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andreev551 [17]
3 years ago
5

Whoever answers correctly I’ll give you a Brainly

Chemistry
2 answers:
LekaFEV [45]3 years ago
4 0
B. energy is released
Andre45 [30]3 years ago
3 0

Answer:

answer is B

Explanation:

You might be interested in
PLEASE HELP MEEE!!!!
Assoli18 [71]
It would be 35.8 Calories or calories. Not sure about that part. Hope this helps though.
3 0
3 years ago
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
3 years ago
Using the thermodynamic information in the ALEKS Data tab, calculate the boiling point of titanium tetrachloride . Round your an
ddd [48]

Answer:

The boiling point is 308.27 K (35.27°C)

Explanation:

The chemical reaction for the boiling of titanium tetrachloride is shown below:

TiCl_{4(l)} ⇒ TiCl_{4(g)}

ΔH°_{f} (TiCl_{4(l)}) = -804.2 kJ/mol

ΔH°_{f} (TiCl_{4(g)}) = -763.2 kJ/mol

Therefore,

ΔH°_{f} = ΔH°_{f} (TiCl_{4(g)}) - ΔH°_{f} (TiCl_{4(l)}) = -763.2 - (-804.2) = 41 kJ/mol = 41000 J/mol

Similarly,

s°(TiCl_{4(l)}) = 221.9 J/(mol*K)

s°(TiCl_{4(g)}) = 354.9 J/(mol*K)

Therefore,

s° = s° (TiCl_{4(g)}) - s°(TiCl_{4(l)}) = 354.9 - 221.9 = 133 J/(mol*K)

Thus, T = ΔH°_{f} /s° = [41000 J/mol]/[133 J/(mol*K)] = 308. 27 K or 35.27°C

Therefore, the boiling point of titanium tetrachloride is 308.27 K or 35.27°C.

5 0
3 years ago
A 15.00 % by mass solution of lactose (C 12H 22O 11, 342.30 g/mol) in water has a density of 1.0602 g/mL at 20°C. What is the mo
Alik [6]

Answer:

22.82M

Explanation:

342.3g/mol is présent in 1000

what about in 15??

( 342.3g/mol × 1000 ) ÷ 15

3 0
2 years ago
How many molecules are in 1 mole of H2O
Olegator [25]

Answer:

A mole (mol) is the amount of a substance that contains 6.02 × 10 23 representative particles of that substance. The mole is the SI unit for the amount of a substance. There are, therefore, 6.02 × 10 23 water molecules in a mole of water molecules. Water (H2O) is made from 2 atoms of hydrogen and 1 atom of oxygen.

8 0
2 years ago
Other questions:
  • The barium isotope 133ba has a half-life of 10.5 years. a sample begins with 1.1×1010 133ba atoms. how many are left after (a) 5
    14·2 answers
  • Which substance is needed in order for this biochemical reaction to occur?
    9·1 answer
  • Hydrogen bonding among water molecules gives water all of the following important properties, except: strong cohesion among the
    5·1 answer
  • What do all prokaryotes and eukaryotes have in common? A. They are unicellular organisms. B. They are multicellular organisms. C
    6·1 answer
  • What do you feel when you're inlove
    5·2 answers
  • What mass of water is required to react completely with 157.35 g CO2? (Molar mass of H2O = 18.02 g/mol; molar mass of CO2 = 44.0
    8·2 answers
  • What element does sodium phosphate and silver nitrate create
    9·1 answer
  • Can someone help me please ?
    12·1 answer
  • 1) Which of the following statements about gases is false?
    14·1 answer
  • The Planet Venus is surrounded by a thick layer of gases. In fact the atmospheric preassure on Venus is over 90 times grater tha
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!