1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
poizon [28]
3 years ago
13

PLEASE HELP BRAINLIEST AND 15 points.

Chemistry
1 answer:
PtichkaEL [24]3 years ago
5 0

Answer:

Substance B, boiling point of 105 °C

Explanation:

Non volatile substances have high boiling points

You might be interested in
An atom that has gained or lost electrons is called _____.
jek_recluse [69]
It called cation, Well, When an atom gains or loses an electron, it attains a net charge and becomes an ion. When electrons are lost, the resulting ion is called cation and when electrons are gained, the resulting ion is called an anion. So, Cations have a net positive charge, while anions have a net negative charge. it is true.
7 0
3 years ago
Read 2 more answers
DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​
Katarina [22]

CGGAUUACGGGCUCAUUGUGGCCA

7 0
3 years ago
What is the hydrogen ion concentration, [H+], of a solution with a pH of 5.43?
grigory [225]

Answer: 3.7 x10−6 Mole per dm^3

Explanation:

pH is the negative logarithm of hydrogen ion concentration in a solution.

So, pH = - log(H+)

Since the solution has a pH of 5.43

5.43 = -log(H+)

To get hydrogen ion concentration, find the Antilog of 5.43

(H+) = Antilog (-5.43)

(H+) = 0.000003715

Then, 0.000003715 in standard form becomes 3.7 x10−6 M

Thus, the concentration of hydrogen ion in the solution is 3.7 x10−6 Mole per dm^3

6 0
3 years ago
a sample of carbon dioxide contains 3.8 moles of oxygen atoms, how many moles of carbon dioxide are in the sample?
dedylja [7]
<h3>Answer:</h3>

1.9 moles

<h3>Explanation:</h3>

Carbon dioxide (CO₂) is a compound that is made up of carbon and oxygen elements.

It contains 2 moles of oxygen atoms and 1 mole of carbon atoms

Therefore;

We would say, 1 mole of CO₂ → 2 moles of Oxygen atoms + 1 mole of carbon atoms

Thus;

If a sample of CO₂ contains 3.8 moles of oxygen atoms we could use mole ratio to determine the moles of CO₂

Mole ratio of CO₂ to Oxygen is 1 : 2

Therefore;

Moles of CO₂ = 3.8 moles ÷ 2

                      = 1.9 moles

Hence, the moles of CO₂ present in a sample that would produce 3.8 moles of Oxygen atoms is 1.9 moles

6 0
3 years ago
Valence electrons are the number of
jenyasd209 [6]

Answer:

an be found by determining the electronic configurations of elements. Thereafter the number of electrons in the outermost shell gives the total number of valence electrons in that element.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Consider the two functions. Which statement is true?
    10·1 answer
  • How many carbon atoms are in four molecules of glucose, or 4C6 H12 O6?
    9·2 answers
  • What type of energy is this?
    7·1 answer
  • The combustion of 135 mg of a hydrocarbon produces 440 mg of CO2 and 135 mg H2O. The molar mass of the hydrocarbon is 270 g/mol.
    8·1 answer
  • A new planet is discovered in a different solar system. The new planet is much like Earth. One difference is that the planet doe
    6·2 answers
  • Calculate the electron contribution to the molar heat capacity at constant volume of silver, CV, at 270 K . Express your result
    8·1 answer
  • How many protons, neutrons, and electrons are there in one atom of 'H ?
    6·1 answer
  • A pile of marbles weigh 394.80 g. 10 marbles weigh<br>37.60 g. How many marbles are in the pile?​
    10·1 answer
  • A sample of a substance has a mass of 7.5 g and a volume of 2.5 cubic centimeters. What is the object’s density?
    10·2 answers
  • Question 8 (1 point)
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!