All categories

2 years ago

Identify three additional ways scientists learn about the Earth's interior.

1 answer:

7 0

The Equator is an imaginary line around the middle of the Earth. It is halfway between the North and South Poles, and divides the Earth into the Northern and Southern Hemispheres. The Equator is the line of 0 degrees latitude. Each parallel measures one degree north or south of the Equator, with 90 degrees north of the Equator and 90 degrees south of the Equator. The latitude of the North Pole is 90 degrees N, and the latitude of the South Pole is 90 degrees S hope this helps

You might be interested in

Help me please!!!!!!!!

alekssr [168]

Answer:

The element is CARBON

The number 6 refers to the ATOMIC NUMBER

the numbers 12, 13, and 14 refer to the ATOMIC MASS

how many protons and neutrons are in the first isotope?

6. 6

how many protons and neutrons are in the second isotope?

6. 7

how many protons and neutrons are in the third isotope?

6. 8

you are welcome :)

8 0

2 years ago

DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte

uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0

2 years ago

A Wisconsin farmer taps a maple tree and collects 200 liters of sap. He determines the sucrose (C12H2011) concentration to be 0.

Minchanka [31]

Answer:

6.0 L

Explanation:

Use the dilution equation M1V1 = M2V2

M1 = 0.075 M

V1 = 200 L

M2 = 2.5 M

V2 = ?

Solve for V2 --> V2 = M1V1/M2

V2 = (0.075 M)(200 L) / (2.5 M) = 6.0 L

4 0

2 years ago

Quizletwhat does the mucosa of the small intestine release in response to the acidic chyme?

Ivenika [448]

Reducing acidity of chyme :Acidic chyme entering the duodenum stimulates the release of secretin from the small intestinal glands.

6 0

10 months ago

You find a compound composed only of element "X" and hydrogen, and know that it is 91.26% element X by mass. Each molecule has 2

worty [1.4K]

Since you know the ratio of atoms, you can start to put a formula togeter. The formula might look like:
XH2.67
but since atoms can't come in fractional amounts, we have to multiply the formula by some number in order to turn 2.67 into a whole #, while still maintaining the ratio. Multiplying 2.67 by 3 yields 8, so the most likely ratio in the molecule is

X3H8so the ratio of 1:2.67 is still maintained. The mass percent tells you that out of every 100g of compound, 91.26g is element X, so the other 8.74g must be H. Dividing each mass by the number of moles in the formula gets us the molar mass of each element (approximately). DIviding 8.74g by 8 gets 1.09, roughly the molar mass of hydrogen. Dividing 91.26g by 3 gets us 30.4, roughly the molar mass of phosphorus. Element X is most likely phosphorus

4 0

2 years ago

Read 2 more answers