1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bulgar [2K]
3 years ago
6

Define the actual distance of the span of the Milky Way galaxy

Biology
1 answer:
Aleks [24]3 years ago
8 0
Distance Information
The Milky Way is about 1,000,000,000,000,000,000 km (about 100,000 light years or about 30 kpc) across. The Sun does not lie near the center of our Galaxy. It lies about 8 kpc from the center on what is known as the Orion Arm of the Milky Way.

Hopefully this helps you!!
You might be interested in
If a person uses up his or her reserve supply of glycogen and still does not eat, sugar comes from the?
Anvisha [2.4K]

If a person uses up his or her reserve supply of glycogen and still does not eat, sugar comes from the muscle.

Although only liver glycogen directly contributes to the release of glucose into circulation, maintaining a healthy blood glucose concentration is one of the glycogen's key functions. Since skeletal muscles lack glucose 6-phosphatase, they are unable to release glucose, and muscle glycogen primarily serves as a local energy source for activity rather than a source of fuel to keep blood glucose levels stable while fasting.

In fact, the breakdown of muscle glycogen into lactate allows for its delivery to the liver, where it participates in the maintenance of euglycemia through the process of gluconeogenesis (Cori cycle).

To learn more about glycogen click here

brainly.com/question/13082214

#SPJ4

6 0
2 years ago
The domestic cat genome contains 2.9×109 base pairs. The length of linker DNA in mammals is 50 base pairs. Approximately how man
IgorLugansk [536]

Answer:

Number of nucleosomes in 2.9 * 10^9bp is equal to 1.47 * 10^7

Explanation:

For wounding one nucleosome, total length of DNA required is equal to 146 bp

The length of  linker DNA in mammals is equal to 50 bp

Thus , the total length of DNA that confides between two nucleosome is equal to the sum of wounding length of DNA and the linker length

= 146 + 50\\= 196bp

Thus, in 196bp length of DNA, the total number of nucleosomes is equal to 1

Thus, number of nucleosomes in 2.9 * 10^9bp is equal to

\frac{2.9* 10^9}{196} \\1.47 * 10^7

8 0
3 years ago
What is the correct sequence of events in transcription and translation?
egoroff_w [7]
The answer is B, DNA to RNA to protein
8 0
3 years ago
If you placed a letter g under a microscope, how would the image look in the field of view?
NeX [460]
Well if you placed the g facing you , it would look upside-down under a microscope , but if you faved it facing the other direction it would look as if it was facing you (the correct way)
4 0
3 years ago
What conclusions can be drawn about the greater
svet-max [94.6K]

The number of sunflower sprouts will be higher than birch tree sprouts because sunflower sprouts have a higher growth rate than birch tree sprouts.

<h3>What is the growth rate?</h3>

Growth rate refers to the ratio of development of a given population and/or biological structure.

The growth rate may result very useful in ecology studies as above mentioned (ecological succession).

In conclusion, the number of sunflower sprouts will be higher than birch tree sprouts because sunflower sprouts have a higher growth rate than birch tree sprouts.

Learn more about the growth rate here:

brainly.com/question/1078756

#SPJ1

4 0
2 years ago
Other questions:
  • What is one major impact of seedless vascular plants?
    9·2 answers
  • 30 points and brainliest. [ !!!!DO NOT!!!! ] copy from google
    7·1 answer
  • Is an organic compound that aids enzyme function by combining with an inactive enzyme to form a catalytically active form?
    14·1 answer
  • Which of these describes loose connective tissue? (A) It is a loose weave of fibers that functions as a packing material. (B) It
    11·1 answer
  • Barbara's teacher wants her to design an oven that can be powered by a renewable resource. Which of the following energy sources
    15·2 answers
  • anonymous anonymous 2 years ago The diagram above shows creep, which is a type of mass movement. Which of the following usually
    6·2 answers
  • How does the chemical equation for cellular respiration compare The one for photosynthesis
    13·1 answer
  • What determaines the kind of genes an organism possesses
    11·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • White Leaf Disease is a devastating disease that
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!