1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ilya [14]
3 years ago
11

Bromine and nitrogen combine to form nitrogen tribromide (NBr3). How many liters of NBr3 gas are produced when 6.85 L of bromine

reacts with excess nitrogen? Assume conditions are at STP.
Chemistry
1 answer:
dlinn [17]3 years ago
7 0

Answer:

4.567 ltr

Explanation:

both are gases

so

N2 +Br2 =NBr3

balancing

N2 +3B2 = 2 NBr3

now

3 litr of B2 gives 2 liter of NBr3

6.85 litr of B2 gives 2/3 *6.85 litr NBr3 = 4.567ltr

You might be interested in
According to "Black Hole Beginnings," what causes the end of a star?
Alisiya [41]

Answer:

when it gets so dense and heavy it implodes, and creates a black hole

Explanation:

7 0
3 years ago
Read 2 more answers
One of the students in lab decided to use two fractionating columns (one on top of the other) instead of just one. How would thi
Andrews [41]

Answer:

See detailed explanation.

Explanation:

Hello there!

In this case, according to the given description, it turns out possible for us to infer that the second fractionating column on top of the first one will favor the light product, in this case hexane as it has the lowest boiling point and molar mass; in such a way, we can tell the following:

a) The separation between hexane and heptane will be increased as a purer hexane-rich product will be obtained on the top of the second column.

b) Will be increased as well, because the second column will remove more heptane.

c) Also, more pure heptane will be obtained on the bottom of the two columns, yet the most favored yield will be that of hexane.

All of the aforementioned is possible due to the fact that the second column will remove the amount of heptane that could not be removed on the top of the first column by taking the vapor-liquid equilibrium further from the first column's maximum separation, which is known as distillation sequences.

Regards!

8 0
3 years ago
Replication, Transcription, and Translation Chart
NemiM [27]

I can help with 1, 2, 3, and 4... 5 and 6, I don't understand.

Template sequence : TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC

Complement sequence : ATGGGAACTTATTTTTTAGTGTCAAACCAGCCATAACAACTTTAG

mRNA sequence : AUGGGAACUUAUUUUUUAGAGACAAACCAGCCAUAACAACUUUAG

Anticodon sequence : AUG-GGA-ACU-UAU-UUU-UUA-GAG-ACA-AAC-CAG-CCA-UAA-CAA-CUU-UAG

(not 6) Protein synthesis : START-Gly-Thr-Tyr-Phe-Leu-Glu-Thr-Asn-Gin-Pro-Stop

6 0
3 years ago
a 0.316 mol sample of nitrogen gas N2(g) is placed in a 4.00 L container at 315 k. what is the pressure in torr of the nitrogen
My name is Ann [436]

Answer:

1550.8

Explanation:

This is the ideal gas equation:

PV=nRT

We can rearrange the ideal gas equation to solve for the pressure of the nitrogen gas.

P=nRT/ V

We can find the pressure of the nitrogen gas by plugging in the values for the moles of gas, temperature, and volume. Since we want the pressure in units of Torr we use the R value62.36358L Torr K−1 mol-1

P=nRT/ V

(0.316 mol )(62.36358 L*Torr/K*mol)(315 K) / 4.00 L =1550 Torr

The correct answer is 1550

5 0
3 years ago
2HNO3+ Cu O -> Cu (NO3)2 + H₂O​
lys-0071 [83]

Answer:

it is already balanced bro

8 0
3 years ago
Other questions:
  • Balance the following reaction: CH4 + O2→ CO2 + H2O<br> 46 points
    14·2 answers
  • In sound wave what is the distance between comprehension called
    8·1 answer
  • I really need help coming up with a three course meal idea, I need this for chemistry, can someone help me please? I need an app
    6·1 answer
  • How many hydrogen bonds can CH3NH2 make to water?
    15·1 answer
  • The mole fraction of nitrogen in the air is 0.7808. this means that 78.08% of the molecules in the air are nitrogen. when the at
    7·1 answer
  • Isooctane, C8H18, is the component of gasoline from which the term octane rating derives.
    13·1 answer
  • A gas container has an initial temperature of 348 K with an unknown pressure. When the temperature changes to 506 K the pressure
    11·1 answer
  • What did you include in your response? Check all that apply.
    14·2 answers
  • Which of the following is a testable hypothesis
    10·1 answer
  • Please help :((
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!