1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Maru [420]
3 years ago
5

Please help and hurry! I'll give brainliest

Chemistry
2 answers:
jonny [76]3 years ago
7 0

Answer:

hi this it for the Instructions: In this engineering lab, you will build and test a device that releases and absorbs

thermal energy in order to reach a goal. You will need to repeat tests of your device to make sure it

does not need to be redesigned or improved. Record your observations and test measurements in

the lab report below. You will submit your completed report. yea that thing the answer is in the file

Explanation:

sorry for telling you on this :( but i hope this helps

Download docx
andrew-mc [135]3 years ago
3 0

Answer:

Explanation:

there yall go i got a 100 on this :)

You might be interested in
What temperature should vegetables be cooked at to hold them hot?
shtirl [24]

Answer:

135°F

Fruits and vegetables that are cooked for hot holding must be cooked to a temperature of 135°F (57.2 °C).

Explanation:

Hope it helps you...

(◍•ᴗ•◍)

4 0
2 years ago
Homeostasis means maintaining
Zielflug [23.3K]

Answer:

Homeostasis is the tendency to resist change in order to maintain a stable, relatively constant internal environment. Homeostasis typically involves negative feedback loops that counteract changes of various properties from their target values, known as set points.

Explanation:

So D. Glad to help! :D

4 0
2 years ago
Read 2 more answers
In which state of matter do the particles spread apart and fill all the space available to them?
xz_007 [3.2K]
Gas, as the particles have the most energy, and thus move the most.
7 0
3 years ago
Two hydrogen atoms covalently bond to form a hydrogen molecule.
ankoles [38]

Answer:

B

Explanation:

the energy of two separate hydrogen atoms decreases as they approach each other, and the single electrons on each atom are shared to form a covalent bond.

7 0
3 years ago
The question is below
pogonyaev
The reaction that has the greatest tendency to be reversed in an spontaneous redox reaction is that whose forward standard reduction potential is the lowest (mos negative) one because that means that the reversed reaction will have the highest (most positive) standard reduction potential.

So, the answer is Cr(3+) + 3e-    ---> Cr(s) with Eo = -0.91 V, whose reversed reaction is Cr(s) - 3e-         ---> Cr (3+) with Eo = +0.91 V.

Answer: the second option Cr(3+) + 3e-    ---> Cr(s)  Eo = -0.91 V
5 0
3 years ago
Other questions:
  • How many liters of oxygen are required to burn 3.86 l of carbon monoxide?
    13·2 answers
  • Alpha decay _____ of an element.
    13·1 answer
  • Word equations for the combustion of wood, natural gas(methane) and ethanol
    5·1 answer
  • How does the light source readout differ from the x-ray readout in the gizmo??
    15·1 answer
  • What type of compounds dissolve easily in water?
    6·2 answers
  • AlCl3 is lewis acid. Explain how?
    5·1 answer
  • Convert 650. J of energy to either kcal or cal
    13·1 answer
  • Como puedo clasificarlos
    13·1 answer
  • Help me out here please?
    5·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!