1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
arlik [135]
3 years ago
8

In 25 words or fewer, what do you think a scientist would want to explain about this soda?

Chemistry
1 answer:
Gnesinka [82]3 years ago
8 0

Answer:

This soda is brown, sweet, has high carbonation, and is about 200 calories when consumed.

Explanation:

:)

You might be interested in
Draw the structure of the fat or oil that would result when a glycerol molecule is
charle [14.2K]

Glycerol will react with 3 butanoic acid molecule to produce glyceryl tributyrate.

Explanation:

You may find the chemical reaction and the structure of molecules in the attached picture.

Learn more about:

triglyceride

brainly.com/question/875089

brainly.com/question/11595668

#learnwithBrainly

3 0
3 years ago
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
3 years ago
What is the total number of protons, neutrons, and electrons in a thallium, TI, atom that has a mass number of 204
a_sh-v [17]

Answer:

Name, Thallium. Symbol, Tl. Atomic Number, 81. Atomic Mass, 204.3833 atomic mass units. Number of Protons, 81. Number of Neutrons, 123. Number of Electrons, 81 ... It has a metallic luster when it is first exposed to air but it tarnish quickly

Explanation:

Hope this helped :)

6 0
3 years ago
What type of bond is between H2?<br>​
Lynna [10]

Explanation:

covalent bond enjoy your anseer

6 0
3 years ago
Read 2 more answers
Is there are a total of 7.3 x 10^29 atoms in a sample of glucose, C6H12O6(s),what amount in miles of glucose is in the sample?
Vadim26 [7]

(7.3 x 10^29 atoms) / (24 atoms/molecule) / (6.022 x 10^23 molecules/mol) =  

5.1 x 10^4 mol C6H12O6

4 0
3 years ago
Other questions:
  • what's the density of an element if a sample has a mass of 43.2 g and a volume of 96.5 mL. (0.45 g/mL)
    7·1 answer
  • What would barium do to obtain a noble gas structure
    11·1 answer
  • Select the single best answer. Consider the following half-reactions: MnO4−(aq) + 8H+(aq) + 5e−→ Mn2+(aq) + 4H2O(l) NO3−(aq) + 4
    7·1 answer
  • If solid water is dropped into liquid water, will the solid iron sink or float?
    11·2 answers
  • Plzz some one tell me tha objection 5 6 points to kekule formula
    7·1 answer
  • Please help, once again. Can't seem to get this...
    9·1 answer
  • The process of converting a liquid into a solid is called (4 points)
    10·2 answers
  • 12. Calculate the hydroxide ion concentration of a solution with pH = 10.25. Show all calculations leading to an answer.
    5·2 answers
  • If the universe is expanding but the expansion is slowing down, what will the eventual
    13·1 answer
  • How does the muscular system work with the respiratory system?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!