1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kolbaska11 [484]
3 years ago
14

Walk done in units time is called​

Physics
1 answer:
____ [38]3 years ago
7 0

Answer:

Explanation:

work done per unit time is caleed power.it's SI unit is watt.it depends upon time.

You might be interested in
In the writing of ionic chemical formulas, what factor is "crossed over" in the crossover rule?
Aleks04 [339]

In the writing of ionic chemical formulas the value of each ion's charge is crossed over in the crossover rule.

Rules for naming Ionic compounds

  • Frist Rule
    The cation (element with a negative charge) is written first in the name then the anion(element with a positive charge) is written second in the name.
  • Second rule
    When the formula unit contains two or more of the same polyatomic ion, that ion is written in parentheses with the subscript written outside the parentheses.
    Example: Sodium carbonate is written as Na₂CO₃ not Na₂(CO)₃
  • Third rule
    If the cation is a metal ion with a fixed charge then the name of the cation will remain the same as the (neutral) element from which it is derived (Example: Na+ will be sodium).
    If the cation is a metal ion with a variable charge, the charge on the cation is indicated using a Roman numeral, in parentheses, immediately following the name of the cation (example: Fe³⁺ = iron(III)).
  • Fourth rule
    If the anion is a monatomic ion, the anion is named by adding the suffix <em>-ide</em> to the root of the element name (example: F = Fluoride).

The oxidation state of each ion is also important, thus in the crossover rule, the value of each ion's charge is crossed over.

Learn more about chemical formulas here:

<u>brainly.com/question/11995171</u>

#SPJ4

3 0
2 years ago
A 2.0-kg block is on a perfectly smooth ramp that makes an angle of 30° with the horizontal. (a) What is the block’s acceleratio
lukranit [14]

Answer:

The forces that do non-zero work on the block are gravity and normal reaction force

Explanation:

5 0
3 years ago
An unusually high tide is called a _______ tide.
Monica [59]
 Proxigean Spring <span>Tide</span>
8 0
3 years ago
How does a model differ from a theory?
yuradex [85]

Answer:

Explained

Explanation:

A model is practical representation of reality with help of various tools called model. It is more purposeful, appealing and provide greater understanding of the specific phenomenon called modeling.

Theory on the other hand are set of written statement which is more generalized and aimed to explain the phenomenon. Theory is developed through the process of abstraction, experimentation, and deduction.

A model is often is used to describe an application of a theory for a specific case.

4 0
3 years ago
I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC
igor_vitrenko [27]

Explanation:

Well A-T have a complementary shape

And C-G have a complementary shape

So replace all Ts for A, and all As for Ts

Replace all Cs for Gs, and all Gs for Cs

You get"

TAACCGGTAACCTTATGGTCAGCTCCGGTGGCTCCGGAATG

7 0
4 years ago
Other questions:
  • Which of the following types of weather data is collected in inches or centimeters?
    15·2 answers
  • PLEASE HELP!!
    11·1 answer
  • Consider the hypothetical observation "a planet beyond Saturn rises in west, sets in east." This observation is not consistent w
    9·1 answer
  • The number 14 is the 'mass number'. What does it tell us about this isotope?​
    6·1 answer
  • What is the build up of electrons on a surface
    11·1 answer
  • A circuit has a voltage drop of 12 V across a 30 2 resistor that carries a
    6·2 answers
  • 20. How much charge will flow through a 2002 galvanometer
    7·1 answer
  • 1. Two vectors have magnitudes 6 &amp; 8 units, respectively. Find the maximum &amp;
    10·1 answer
  • En la siguiente expresión matemáticas w=mg el peso w con relación a se relaciona con la masa m en una proporción
    6·1 answer
  • According to Newton’s law of universal gravitation, which statements are true?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!