1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vera_Pavlovna [14]
3 years ago
12

For a science experiment, a student rubs a mineral against a porcelain plate. The students has just performed

Chemistry
2 answers:
Gemiola [76]3 years ago
6 0
The correct answer is letter B: A streak test.
frosja888 [35]3 years ago
4 0

B.Streak Test.Hope this helps! :)

You might be interested in
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
A gas has a volume of 5.0 L at a pressure of 50 KPa. What happens to the volume when the pressure is increased to 125?
Alexeev081 [22]
The volume becomes two. You have to use the equation P1 x V1 = P2 x V2 
P is pressure and V is volume.
P1 = 50     P2 = 125
V1 = 5       V2 = v (we don't know what it is)
Then set up the equation:
50 times 5 = 125 times v
250 = 125v
the divide both sides by 125 and isolate v
2 = v
Therefore the volume is decreased to 2.
Also, Boyle's Law explains this too: Volume and pressure are inversely related, This means that when one goes up the other goes down (ie when pressure increases volume decreases and vice versa). Becuase the pressure went up from 50 KPa tp 125 KPa the volume had to decrease.

7 0
3 years ago
What is one example of boyles law
damaskus [11]
One of the examples of Boyles law in action is a syringe 




3 0
3 years ago
How many grams are 0.5 moles of NaCl???
elena-14-01-66 [18.8K]

Answer:Respuesta. El peso molecular de NaCl es 58gr que equivale a 1 mol. g? hay 0,5mol queda 29gr

Explanation:

3 0
2 years ago
How could you use a model to show the cause-and-effect relationship between Earth's rotation and the apparent motion of the star
Masteriza [31]

Question:

How could you use a model to show the cause-and-effect relationship between Earth's rotation and the apparent motion of the stars across the night sky?

Answer:

Gravity? or density because of the pull from the sun.

7 0
3 years ago
Read 2 more answers
Other questions:
  • Which statements describe Rutherford’s model of the atom? Select all that apply.
    11·1 answer
  • The pH of a solution can be determined with an instrument called a pH meter. The following data was collected with the
    11·1 answer
  • Which best describes a difference between electric current and static electricity? a. Electric current is continuous, and static
    10·1 answer
  • Why will heat travel faster in solids than in liquids
    6·1 answer
  • You notice something is growing in a 100ml pot of liquid soap. You take 1ml of this liquid soap and perform a serial dilution an
    14·1 answer
  • A 250mL sample of oxygen is collected over water at 30 C and 850 torr pressure. What is the pressure of the dry gas alone?
    13·1 answer
  • I WILL MARK BRAINLIEST
    6·2 answers
  • Which do you use to qualify matter?
    8·1 answer
  • Write down the names of compounds represented by the following formulae:
    8·1 answer
  • You and your science group have been handed five mineral samples to identify. First, you sort the minerals by color. One has man
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!