1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slamgirl [31]
3 years ago
6

What kind of mixture is the iron fillings and water ? Please explain !!!!!!!!!!!! Will mark brainliest !!!!!!!!!!!!!!!!!!!!!

Chemistry
1 answer:
olga2289 [7]3 years ago
6 0

Answer:

A magnet ( Magnetic attraction ) is used to separate the solid mixture that contain magnetic substances such as mixture of sand and iron fillings . Filtration process is used to separate solid materials that are insoluble in water such as mixture of sand ( or mud ) and water.

Explanation:

You might be interested in
Helllpppp!!!!!! Please
pav-90 [236]

Answer: (C) Statements (i) and (iii)

Explanation: According to byjus.com, group VII elements are known as Halogens.

Not only that, but bbc.co.uk says " Atoms of group 7 elements all have seven electrons in their outer shell. This means that the halogens all have similar chemical reactions ."

It may just be (b) though as these are chemical reactions.

3 0
2 years ago
Sodium has the atomic number 11. How many electrons are in a sodium ion, which has the symbol Na+? 10 11 12 NextReset © 2017 Edm
Anna71 [15]
Na 1s²2s²2p⁶3s¹
↓ - e⁻
Na⁺ 1s²2s²2p⁶    2+2+6=10 e⁻

10 electrons are in sodium ion Na⁺
4 0
3 years ago
How do I convert units the easiest
damaskus [11]
To convert among units in the metric system, identify the unitthat you have, the unit that you want to convert to, and then count the number of units between them. If you are going from a larger unit to a smaller unit, you multiply by 10 successively
7 0
4 years ago
What is science......?​
den301095 [7]

\huge \underbrace \mathfrak \blue{Answer}

<u>Science is a systematic enterprise that builds and organizes knowledge in the form of testable explanations and predictions about the universe. The earliest roots of science can be traced to Ancient Egypt and Mesopotamia in around 3000 to 1200 BCE.</u>

\\

5 0
3 years ago
Read 2 more answers
How can the gravitational potential energy of an object be changed?
Aleksandr [31]

Answer:

Gravitational potential energy may be converted to other forms of energy, such as kinetic energy. If we release the mass, gravitational force will do an amount of work equal to mgh on it, thereby increasing its kinetic energy by that same amount (by the work-energy theorem).

Explanation:

7 0
3 years ago
Other questions:
  • A 130.0−mL sample of a solution that is 3.0×10−3M in AgNO3 is mixed with a 225.0−mL sample of a solution that is 0.14M in NaCN.
    11·1 answer
  • N a 3 P O 4 (aq)+L i 2 S O 4 (aq)→ Express your answer as a chemical equation. Enter NOREACTION if no reaction occurs. Identify
    10·1 answer
  • You have a 5-liter container with 1.30×10^24 molecules of ammonia gas (NH3) at STP.
    14·2 answers
  • When you weigh yourself on good old terra firma (solid ground), your weight is 151 lb . in an elevator your apparent weight is 1
    14·1 answer
  • In an ionic bond:
    8·2 answers
  • The element Oxygen, O, is an example of which of the following?
    13·2 answers
  • Which of the following pairs of elements is most likely to form a covalent bond? A. Sodium and chlorine B. Magnesium and Oxygen
    9·1 answer
  • Use Table 1 below to answer the following question: Scientists find a piece of wood that is thought to be from an ancient fire c
    15·1 answer
  • Which of these has the most kinetic energy?
    9·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!