Answer:
Energy transfers to the metal from the water and calorimeter until they are all at room temperature.
Explanation:
i hope this helps
Answer:
15 people x 4 slices so you’ll need 60 pieces
60/12(the amount of slices per pizza) =5
You need 5 pizzas. $14.78 x 5 = 73.90.
Explanation:
the answer is that one 73.90 is rounded nearest cent : ) took me a while to get it
True will end up being the answer
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
The chemical formula C₂H₆O, which is designated as option D, is equivalent to this structural formula.
<h3><u>What is a Chemical Formula ?</u></h3>
Chemical element symbols, numbers, and occasionally additional symbols like parentheses, dashes, brackets, commas, and plus (+) and minus () signs are used in a chemical formula to represent information about the chemical proportions of the atoms that make up a certain chemical compound or molecule.
- An empirical formula represents by symbols, such as Na for sodium and Cl for chlorine, with subscripts that show the relative number of atoms in each.
- The composition of any member of an entire class of compounds can be represented by a general formula, a sort of empirical formula.
To know more about Chemical formulas, refer to:
brainly.com/question/26388921
