1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LuckyWell [14K]
3 years ago
12

The elements potassium (K), Calcium (Ca), and Krypton(Kr) are all part of the same __________ on the periodic table. A) Diagonal

B) Group C) Period D) Column
Chemistry
1 answer:
Pavel [41]3 years ago
6 0
The answer is C, I believe.
You might be interested in
Which type of bonding is most important in ch3ch2ch2ch2ch2ch3?
saveliy_v [14]

The compound CH_3CH_2CH_2CH_2CH_2CH_3 is formed only by sharing of electrons between the atoms. The structure of the compound is shown in the image.

Each line between two atoms represents the sharing of an electron pair which results in the formation of a single bond. Since, carbon has 4 electrons in its valence shell and hydrogen has 1 electron in its valence shell so in order to complete the octet ( to have 8 electrons in their valence shell, noble gas configuration) to attain stability carbon needs 4 more electrons and hydrogen needs 1 electron. So, sharing of electron will occur as shown in the image and the formed compound is stable in nature.

Since, the bond that is formed by sharing of electrons between atoms is known as covalent bond. So, covalent bonding is most important in CH_3CH_2CH_2CH_2CH_2CH_3.

7 0
4 years ago
A sample of an ideal gas has a volume of 2.30 L at 281 K and 1.02 atm. Calculate the pressure when the volume is 1.41 L and the
Vlad1618 [11]

A sample of an ideal gas has a volume of 2.30 L at 281 K and 1.02 atm. 1.76 atm is the pressure when the volume is 1.41 L and the temperature is 298 K.

<h3>What is Combined Gas Law ?</h3>

This law combined the three gas laws that is (i) Charle's Law (ii) Gay-Lussac's Law and (iii) Boyle's law.

It is expressed as

\frac{P_1V_1}{T_1} = \frac{P_2V_2}{T_2}

where,

P₁ = first pressure

P₂ = second pressure

V₁ = first volume

V₂ = second volume

T₁ = first temperature

T₂ = second temperature

Now put the values in above expression we get

\frac{P_1V_1}{T_1} = \frac{P_2V_2}{T_2}

\frac{1.02\ atm \times 2.30\ L}{281\ K} = \frac{P_2 \times 1.41\ L}{298\ K}

P_{2} = \frac{1.02\ atm \times 2.30\ L \times 298\ K}{281\ K \times 1.41\ L}

P₂ = 1.76 atm

Thus from the above conclusion we can say that A sample of an ideal gas has a volume of 2.30 L at 281 K and 1.02 atm. 1.76 atm is the pressure when the volume is 1.41 L and the temperature is 298 K.

Learn more about the Combined gas Law here: brainly.com/question/13538773

#SPJ4

4 0
2 years ago
1) Write the symbol and charge for each individual ion
ololo11 [35]

N -3

Ba +2

Sr +2

F -1

I -1

Ca +2

Mg +2

S -2

S -2

Al +3

//

Ba3N2

SrF2

CaI2

MgS

Al2S3

//

I don't really understand 2.

3 0
3 years ago
If we were to dissolve iodine in alcohol, which term would describe the alcohol?
marishachu [46]
It will be Solvent the term that would describe the alcohol will be solvent.
4 0
3 years ago
The Goodyear blimp contains 5.7 x 10^6 L of helium at 25 degrees Celsius and 1 atm. What is the mass in grams of the helium insi
anygoal [31]

Answer:

1.72x10⁻⁵ g

Explanation:

To solve this problem we use the PV=nRT equation, where:

  • P = 1 atm
  • V = 5.7x10⁶ L
  • n = ?
  • R = 0.082 atm·L·mol⁻¹·K⁻¹
  • T = 25 °C ⇒ (25+273.16) = 298.16 K

And we <u>solve for n</u>:

  • 1 atm * 5.7x10⁶ L = n * 0.082 atm·L·mol⁻¹·K⁻¹ * 298.16 K
  • n = 4.29x10⁻⁶ mol

Finally we <u>convert moles of helium to grams</u>, using its <em>molar mass</em>:

  • 4.29x10⁻⁶ mol * 4 g/mol = 1.72x10⁻⁵ g

8 0
3 years ago
Other questions:
  • Can someone's help me with this
    12·1 answer
  • Which solute produces the highest boiling point in a 0.15 m aqueous solution?
    7·1 answer
  • How many atoms are in 1 mole of gold
    12·1 answer
  • Benzene is a starting material in the synthesis of nylon fibers and polystyrene (styrofoam). Its specific heat capacity is 1.74
    9·1 answer
  • What is the mass of 6.78x1050 molecules of NaCl
    12·1 answer
  • How many grams of dextrose are needed to make 725 mL of a 26.0% (w/v) dextrose solution? Note that mass is not technically the s
    10·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • SOMEONE PLZZ help me on this chemistry test I need to pass it to be able to get my grade up :(((
    14·1 answer
  • Write balanced equation for:
    8·1 answer
  • Why are 1-chlorobutane and 2-chlorobutane structural isomers?.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!