1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
-BARSIC- [3]
3 years ago
12

What does the word "reliable" mean?

Biology
2 answers:
wariber [46]3 years ago
5 0
The last answer box: Can be depended on
enot [183]3 years ago
3 0

Answer:

the answer it can be depended on.

You might be interested in
Atoms in molecules share pairs of electrons when they make
Reil [10]
Atoms in molecules share pairs of electrons when they make ionic bonds.
6 0
4 years ago
What subunits form starch?
BaLLatris [955]
Carbohydrates: fructose, glucose, and <span>lactose</span>
4 0
3 years ago
WILL GIVE A BRAINLEST
SpyIntel [72]
Convergent evolution according to my records
6 0
3 years ago
Read 2 more answers
Which vessel directly supplies the heart muscle with blood?
WITCHER [35]
The Coronary Arteries vessel directly supplies the Hear muscle with Blood. 
4 0
3 years ago
You classified organisms based on anatomical structure and development. Scientists also use DNA to classify organisms. Consideri
Luda [366]

The evolution of molecular biology has made possible to establish a new classification of all organisms according to their DNA, and it's called phylogenetic classification. This classification group living beings according to their kinship it is established according to anatomical, and especially genetic, based on the similarity of genes between species.

This made it possible to discover kinship ties between species of which there is no suspicion of any morphological link between them, something which the old classification (the traditional classification) was incapable of doing (and this proves the importance of the DNA and genes in organisms classification.

3 0
3 years ago
Other questions:
  • based on the fact that people can get cancer regardless of their genetics, what are some things you can do to lower your risks o
    10·1 answer
  • 1. The head is made up of bones that form the
    5·1 answer
  • 8.
    6·2 answers
  • Which physical property is best measured using only a balance?
    12·1 answer
  • Can y’all tell me which ones I got wrong please. Thank you!!
    7·1 answer
  • What is parasympathetic nervous system
    12·1 answer
  • Definitely whether these substances are solid liquid or gas
    9·1 answer
  • John observed that left over pineapple kept at 15 oC in the refrigerator tastes sweater than pineapple consumed just after being
    11·1 answer
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • 16. Which statement is not true of an ecosystem F. Organism develop adaptations to survive
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!