1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elena L [17]
3 years ago
12

What do atoms form when they share electron pairs molecules isotopes elements?

Chemistry
1 answer:
Ksivusya [100]3 years ago
6 0
The answer to this item is the first choice, MOLECULES. The molecules are the smallest particles of both the compounds and even the biatomic elements. They are made up of atoms that are being held together through chemical bonds of different types depending on the type of atoms that shared the electrons. 
You might be interested in
Which molecule has the greatest difference in electronegativity (DE) between the two different elements? A. CO_2 B. H_2S C. NH_3
Natalka [10]

Answer:

Water has the greatest ΔEN

ΔEN H₂O → 3.4 - 2.1 = 1.3   Option D.

Explanation:

We should find the Electronegativity data in the Periodic table for all the elements:

C : 2.6

O: 3.4

H: 2.1

S: 2.6

N: 3.0

a. ΔEN CO₂ → 3.4 - 2.6 = 0.4

b. ΔEN H₂S → 2.6 - 2.1 = 0.5

c. ΔEN NH₃ → 3 - 2.1= 0.9

d. ΔEN H₂O → 3.4 - 2.1 = 1.3

3 0
3 years ago
Please help with this chemistry question it’s due by midnight
Scilla [17]

Answer:

HF is the limiting reactant

Explanation:

The balanced equation for the reaction is given below:

SiO₂ + 4HF —> SiF₄ + 2H₂O

From the balanced equation above,

1 mole of SiO₂ reacted with 4 moles of HF.

Finally, we shall determine the limiting reactant. This can be obtained as illustrated below:

From the balanced equation above,

1 mole of SiO₂ reacted with 4 moles of HF.

Therefore, 7.5 moles of SiO₂ will react with = 7.5 × 4 = 30 moles of HF.

From the calculation made above, we can see clearly that it will take a higher amount (i.e 30 moles) of HF than what was given from the question (i.e 5 moles) to react completely with 7.5 moles of SiO₂.

Therefore, HF is the limiting reactant and SiO₂ is the excess reactant.

3 0
3 years ago
A student increases the temperature of a 200 cm3 balloon from 60⁰C to 180⁰C. What should the new volume of the balloon be? Use t
lara [203]
236 cm3 Is the correct answer..
5 0
2 years ago
Read 2 more answers
What mass of sucrose (C12H22O11) should be combined with 546 g of water to make a solution with an osmotic pressure of 8.80 atm
lesya [120]

<u>Answer:</u> The mass of sucrose required is 69.08 g

<u>Explanation:</u>

To calculate the concentration of solute, we use the equation for osmotic pressure, which is:

\pi=iMRT

Or,

\pi=i\times \frac{\text{Mass of solute}\times 1000}{\text{Molar mass of solute}\times \text{Volume of solution (in mL)}}\times RT

where,

\pi = osmotic pressure of the solution = 8.80 atm

i = Van't hoff factor = 1 (for non-electrolytes)

Mass of solute (sucrose) = ?

Molar mass of sucrose = 342.3 g/mol

Volume of solution = 564 mL    (Density of water = 1 g/mL)

R = Gas constant = 0.0821\text{ L.atm }mol^{-1}K^{-1}

T = Temperature of the solution = 290 K

Putting values in above equation, we get:

8.80atm=1\times \frac{\text{Mass of sucrose}\times 1000}{342.3\times 546}\times 0.0821\text{ L.atm }mol^{-1}K^{-1}\times 290K\\\\\text{Mass of sucrose}=\frac{8.80\times 342.3\times 546}{1\times 1000\times 0.0821\times 290}=69.08g

Hence, the mass of sucrose required is 69.08 g

5 0
2 years ago
235
gizmo_the_mogwai [7]
Huh? . . . . . . . . : )
7 0
2 years ago
Read 2 more answers
Other questions:
  • PLEASE HELP why does the atomic radius of elements increases when you go down the Periodic Table
    6·1 answer
  • How many valence electrons are represented in the following electron configuration? 1s22s22p5
    7·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • A(n) ______ is an organic compound in which a carbonyl group is bonded to two different carbon atoms.
    9·2 answers
  • The observation has to be made up and i can’t think of anything or a hypothesis who can help!
    9·1 answer
  • What is the ΔG given the following? ΔH = 20 kJ/mol T = 15°C ΔS = .101 kJ/molK
    14·1 answer
  • Is this true or false a line graph shows the relationship between three variables
    14·2 answers
  • Sebastian watches his cat run out Into the yard, look at a bug, and then run back to the
    12·1 answer
  • IF anyone didn't do this E D G E N U I T Y thing here you guys go pass it around to people that need help this is what it is cal
    14·1 answer
  • The Temperature of the earth gets______ as you get closer to the _______ and ________ as you move towards the_____
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!