1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksley [76]
2 years ago
10

5.(06.04B MC)

Chemistry
1 answer:
NARA [144]2 years ago
7 0

Answer:

Explanation:

1. The reaction will proceed backward, shifting the equilibrium position to the left.

2. The reaction will proceed forward, shifting the equilibrium position to the right.

3. Either add more of the products ( H2O or Cl2) or remove the reactant (HCl or O2)

You might be interested in
The Hawaiian islands formed as a result of a hot spot.<br><br> A.)True <br><br> B.)False
choli [55]

Hello,

That is true.

8 0
3 years ago
Read 2 more answers
Given the reaction:
STatiana [176]

answer:

as per the formula of given carbohydrate the answer is 15 moles

explanation:

  • 1 mole carbohydrate contains 6 moles water
  • 2.5 moles contain 6 X 2.5 = 15 moles
7 0
3 years ago
URGENT!!! What is the balanced form of this equation?
Ostrovityanka [42]

Explanation: This is a reaction of oxidation of H_2O_2 in the presence of acidified KMnO_4. Acidified KMnO_4 is a strong oxidizing agent.

To balance out the H^+ on the reactant side, we write H_2O on the product side.

Balancing out the following reaction gives us:

2MnO_4^-+6H^++5H_2O_2\rightarrow 2Mn^{2+}+8H_2O+5O_2

5 0
3 years ago
Is o-toluic acid soluble in ether, NaOH?, Is Napthalene soluble in NaOH?
natima [27]
Yes, o-toluic acid is soluble in ether as ether is slightly polar and it is soluble in NaOH because it is likely to form soluble compounds with it.

Naphthalene is insoluble in NaOH.
8 0
3 years ago
Any method of determining whether an event or object is older or younger than others
Inga [223]
The answer is relative dating, btw

6 0
3 years ago
Read 2 more answers
Other questions:
  • What are the products of the neutralization reaction of KOH with HCL
    7·1 answer
  • Determine the volume of a 75-gram sample of gold at stp
    5·1 answer
  • How do you calculate the number of protons, neutrons, and electrons in an element?
    7·1 answer
  • The taste of acid is sour​
    6·2 answers
  • For the balanced equation shown below how many grams of O2 reacted if 2420 of p4O10 are produced
    9·1 answer
  • 20 POINTS!<br><br> what would be an example of an everyday household acid and base?
    13·2 answers
  • A 35 L tank of oxygen is at 315 K with an internal pressure of 190 atmospheres. How
    10·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Compare and contrast the carbon cycle of 1500 and of 2021
    11·1 answer
  • HELPPP MEEEEE!!!POR FAVOR
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!