1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Burka [1]
4 years ago
12

1. What is the cause of the Coriolis effect?

Chemistry
2 answers:
yulyashka [42]4 years ago
8 0
1.) The answer would be D.Earth's rotation, since the rotation makes the air and wind direction appear to be going in a different direction than it really is due to the earth rotating (this deflects the winds)
2.) The answer would be C.Relative Humidity, since this is ratio of water vapor in the air to a given area, while humidity is simply the amount of water vapor in the air in general.
3.) B. Warm Front, since cold fronts usually bring stormy weather, while the weather conditions brought by a warm front are typically more mild. 
4.) For this one, I'm not sure, but I'm pretty sure the closest answer would be C.4. The way I have learned this is that there have been 5 major ice ages, however the choice isn't on there. 


Ostrovityanka [42]4 years ago
7 0
For number one I think it’s D
You might be interested in
which occupies a larger volume, 600 g of water (with a density of 0.995 g/cm3 ) or 600 g of lead (with a density of 11.35 g/cm3
Montano1993 [528]
Water will occupy larger volume
5 0
3 years ago
Why is a balanced symbol equation better at describing the reaction than a word equation
AleksandrR [38]

Answer:

The advantages described below

Explanation:

Advantages of a balanced chemical equation versus word equation:

  • easier to read: chemical equations typically only take one line and they include all the relevant information needed. They are short-hand notations for what we describe in words.
  • balanced chemical equations show molar ratio in which reactants react and the molar ratio of the products. Those are coefficients in front of the species. This is typically not included in a word equation, for example, hydrochloric acid reacts with potassium hydroxide. The latter statement doesn't describe the molar ratio and stoichiometry.
  • includes relevant information, such as catalysts, temperature and pressure above the arrow in the equation. We wouldn't have this in a word equation most of the time.
  • shows the stoichiometry of each compound itself, e. g. if we state 'ammonia', we don't know what atoms it consists of as opposed to NH_3].
  • includes states of matter: aqueous, liquid, gas, solid. This would often be included in a word equation, however.
5 0
3 years ago
Which gas would diffuse rapidly at the same temperature and pressure UF6 or CL2
svetoff [14.1K]

Answer:

UF6

Explanation:

6 0
3 years ago
Which statement is most likely a scientific law?
Annette [7]

Answer:

we need to see the statements

Explanation:

6 0
3 years ago
Read 2 more answers
How is the number of unpaired valance electrons in an atom related to the number of bonds that the atom can form?
TiliK225 [7]
It is the same amount. For example, Carbon has 4 electrons. Putting those 4 electrons in a Lewis Dot Structure will show that they are not paired, so 4 is the number of bonds Carbon can make.
6 0
3 years ago
Other questions:
  • How many protons electrons and neutrons does the isotope nitrogen 15 have
    7·1 answer
  • Given these reactions, X ( s ) + 1 2 O 2 ( g ) ⟶ XO ( s ) Δ H = − 668.5 k J / m o l XCO 3 ( s ) ⟶ XO ( s ) + CO 2 ( g ) Δ H = +
    9·1 answer
  • Examples<br> 1) How many atoms of silver are there in 4.5 moles of silver? [Ag = 107.8682 g/mol]
    6·2 answers
  • Values for the molar mass of nitrogen, oxygen, and nitrogen dioxide molecules are given in the table below. What mass of nitroge
    8·1 answer
  • Explain why constructive and destructive forces are considered competing forces.
    14·1 answer
  • We use less than 1% of the water on Earth for
    12·2 answers
  • It would most likely be difficult to collect a sample of which isotope? Pb-206 Po-214 U-234 Ra-226
    6·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Help me out please!?
    8·1 answer
  • Which element is classified as a metal?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!