1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elena55 [62]
3 years ago
5

In order for fission reactions to be successful, they must be self-perpetuating, meaning they must be able to keep themselves go

ing.
What do you call the minimum amount of material that is needed for the reaction to keep going?

A) isotope
B) mass defect
C) critical mass
D) neutron
Chemistry
1 answer:
aleksandrvk [35]3 years ago
3 0

Answer:

Option C is correct.

The minimum amount of material that is needed for a fission reaction to keep going is called the critical mass.

Explanation:

Nuclear fission is the term used to describe the breakdown of the nucleus of a parent isotope into daughter nuclei.

Normally, the initial energy supplied for nuclear fission is the energy to initiate the first breakdown of the first set of radioactive isotopes that breakdown. Once that happens, the energy released from the first breakdown is enough to drive further breakdown of numerous isotopas in a manner that leads to more energy generation.

But, for this to be able to be sustained and not fizzle out, a particular amount of radioactive material to undergo nuclear fission must be present. This particular amount is termed 'critical mass'

Hope this Helps!!!

You might be interested in
Freezing a candy bar is an example of a physical change. <br> True or false
Debora [2.8K]

Answer: This is true.

Explanation:  

 It is true because if becomes frozen, then it is physically harder to melt...

6 0
2 years ago
Asap! first to answer correctly gets 10 pts plus brainliest! :)
olga_2 [115]

Answer:

c

Explanation:

c first quarter waxing half moon

6 0
3 years ago
Which subscripts would properly complete the formula unit Al_N_?
MakcuM [25]
I believe that it would be Al1N1.
4 0
3 years ago
Assume the weight of an average adult is 70. kg, and that 420. kJ of heat are evolved per mole of oxygen consumed as a result of
seraphim [82]

Answer:

The temperature difference of the body after 3 hours = 5.16 K

Explanation:

we know that the number of moles of O₂ inhaled are 0.02 mole/min⁻¹

                                   or, 1.2 mole.h⁻¹

The average heat evolved by the oxidation of foodstuffs is then:

⇒          Q avg =\frac{1.2 X 420 X 10^{3} }{70} = 7.2 kj.h⁻¹.Kg⁻¹

the heat produced after 3 h would be:

                 =    7.2 kj. h⁻¹.Kg⁻¹ x 3 h

                 = 21.6 kj. kg⁻¹

                 = 21.6 x 10³ j kg⁻¹

We know Qp = Cp x ΔT

Assume the heat capacity of the body is 4.18 J g⁻¹K⁻¹

⇒ ΔT = \frac{Qp}{Cp}

⇒ ΔT = \frac{(21.6 X 10^{3} j.kg^{-1} ) }{(4.18 j k^{-1}g^{-1})   X (1000g.kg^{-1} )}

⇒ ΔT = 5.16 K

6 0
3 years ago
How many grams of aluminum will<br> react fully with 1.25 moles Cl₂?
Liula [17]

2Al + 3Cl₂ → 2AlCl₃

mol Al = 2/3 x 1.25 = 0.83

mass Al = 0.83 x 27 g/mol = 22.41 g

3 0
2 years ago
Other questions:
  • A 126.1-gram block of granite at 92.6°C is dropped into a tub of water at 24.7°C in an isolated system. The final temperature of
    7·1 answer
  • Need help on number 14 please and thank u so much
    10·1 answer
  • Which alcohol reacts with c2h5cooh to produce the ester?
    11·1 answer
  • 2. Which determines the identity of an
    6·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Identify the electrophilic site in the following molecule, CH_3CH_2NHCH_2CH_3. (A) H (B) N (C) CH_2 (D) CH_3 (E) there is no ele
    8·1 answer
  • Which electron are the valence electron of the atom
    7·1 answer
  • Some plants have tap roots; long roots that grow deep into the ground. Where would tap roots for plants be MOST useful?
    11·1 answer
  • 1. Which kingdom is made up of only autotrophs?
    5·1 answer
  • Based on the electron configuration of the two
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!