1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nadya [2.5K]
2 years ago
5

What does a bird , beetle and a fungus have in common

Chemistry
2 answers:
katovenus [111]2 years ago
6 0

They are all necessary living organisms!

hope this helps, good luck! :)

Nostrana [21]2 years ago
4 0

Answer: They all must go through varying biological reactions to formulate energy from nutrients and molecules.

Explanation:

You might be interested in
A sample of sodium hydroxide (NaOH) has a mass of 160.0 g. The molar mass of NaOH is 40.00 g/mol. How many moles of NaOH does th
NARA [144]

Answer:

400 becuase NAOH AND TJE NAOH ARE THE same

Explanation:

6 0
2 years ago
Read 2 more answers
When you divide the mass of a substance by its volume, you get its.
Zarrin [17]

Answer:Density

Explanation:

8 0
3 years ago
Read 2 more answers
What is the pressure of a 3.5 mmol sample of ethane (C2H6) gas contained in a 0.500 L flask at 298 K?
-BARSIC- [3]
P = nRT/V

P = 3.5 x 10^-3 x 0.082 x 298 /0.5

P = 0.171 m Hg

P = 171 mm Hg

hope this helps
8 0
3 years ago
Which chemical equation shows that the total mass during a chemical reaction stays the same?
k0ka [10]

Answer:

  • Option A) <u><em>Mg + Cl₂ → MgCl₂</em></u>

Explanation:

The law of conservation of mass is guaranteed in a chemical equation. Since the mass of the atoms do not change, that means that the number of each kind of atoms in the reactant side is equal to the number of atoms of the same kind in the product side.

The first equation is:

<em><u>A) Mg + Cl₂ → MgCl₂</u></em>

<u />

Number of atoms:

        atom      Reactant side        Product side

          Mg                1                              1

           Cl                 2                             2

Therefore, the table displays that there are the same number of atoms of each kind on both sides, showing that<em> the total mass during the chemical reaction stays the same.</em>

<u />

<em><u>B) NaOH + MgCl₂ → NaCl + MgOH</u></em>

This equation displays 2 atoms of Cl on the left side and 1 atom of Cl on the right side; thus, it is not showing that the total mass stays the same during the chemical reaction.

<em />

<u><em>C) 2Na + 2H₂O → NaOH + H₂</em></u>

Neither the sodium, nor oxygen, nor hydrogen atoms are balanced. Thus, this does not show that the total mass stays the same.

<u><em /></u>

<u><em>D) H₂O + O₂ → H₂O</em></u>

The reactant side contains 3 oxygen atoms and the product side contains 1 atoms of oxygen; thus, this is not balanced: it does not show that the total mass stays de same during the chemical reaction.

5 0
3 years ago
Read 2 more answers
Avogadros number is used to determine the number of subatomic particles in an atom. True or false
Yuliya22 [10]

Answer:

False

Explanation:

The Avogadro's number is not used to determine the number of subatomic particles in an atom.

Subatomic particles of an atom are the protons, neutrons and electrons.

The protons are the positively charged particles in an atom

Neutrons do not carry any charges

Electrons carry negative charges.

 The number of protons, neutrons and electrons in an atom are experimentally determine using spectrometric techniques.

7 0
3 years ago
Other questions:
  • if 45.0 ml of 1.50 M Ca(OH)2 are needed to neutralize 25.0 ml of HI of unknown concentration, what is the molarity of the HI?
    10·1 answer
  • How many moles of heptane will completely react with 1.42 of molecular oxygent
    7·1 answer
  • A balloon contains 0.140 molmol of gas and has a volume of 2.78 LL . If an additional 0.152 molmol of gas is added to the balloo
    15·1 answer
  • When a highly reactive metal, such as lithium (Li), is mixed with a highly reactive nonmetal, such as chlorine (Cl), they will m
    7·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • How many significant figures are in 1.00 L
    15·1 answer
  • Which of the following is a property of a pure substance?
    11·2 answers
  • Does anyone have the student exploration sheet answers for the Drug Dosage (Forensic Science) Gizmos lab?​
    6·1 answer
  • Which best describes the difference between Mitosis and Meiosis?
    9·1 answer
  • Define 'hellowin '<br>is it celebrated ?​
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!