1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vitfil [10]
3 years ago
12

Avoid of diseases in monsoon season-

Chemistry
1 answer:
Dominik [7]3 years ago
4 0

Answer:

Monsoon seasonal diseases can be avoided by keeping surroundings clean, removing stagnant water, eating homemade food, washing hands properly, eating clean and drinking boiled water.

Explanation:

1. Make efforts in making the environment mosquito free by proper cleaning and removing stagnant water as well.

2. Use mosquito repellant, mainly net that has no side effects and is ecofriendly.  

3. Avoid moving to crowded places to prevent viral infections.

4. Consume food made at home and boiled water.

5. Wash hands before consuming food.

You might be interested in
WHAT DOES THIS SAY AND WHAT THE ANSWER
notka56 [123]

It says

The majority of elements on the periodic table are ______________ (metals, nonmetals, or metalloids).  

The periodic table on the left separates elements into three groups: the metals (green in the table), nonmetals (orange), and metalloids (blue). Most elements are metals.

Apr 18, 2003

4 0
3 years ago
How many moles in 2.0g of carbon dioxide?
ANEK [815]
First you need to find out the Limiting reactant (LR). convert both reactants to the same thing. Check that the chemical equation is balanced.  Now use stoichiometr and remember at moles, multiply: need moles, divide2 g / 42g/mol=  0.0477 mol propane         mass propane/ Molar Mass propane = moles propane4 g / 32 g/mol= 0.125 mol oxygen X (1 mol/ 5 mol) = 0.025 mol propane   oxygen is the LRmass O2 / MM O2 X (mol propane / mol O2)0.025 mol X (3 mol / 1 mol ) = .075 mol CO20.075 mol X (12 + 2*16) g /mol = 3.6 g CO2 In one step:2 g / 42g/mol X (3 mol / 1 mol ) X 48 g/mol = 6.86 g CO24 g / 32 g/mol X (3 mol / 5 mol ) X 48 g/mol = 3.6 g CO2mass/ MM        X coefficient ratio  X MM (new)
4 0
3 years ago
A 12.630 g milk chocolate bar is found to contain 8.315 g of sugar. part a part complete how many milligrams of sugar does the m
kolezko [41]
Answer:
A 12.630 bar of chocolate contains 8315 milligrams of sugar

Explanation:
From the basics of conversion, we can find that:
1 gram is equal to 1000 mg
Using cross multiplication, we can find how many milligrams are present in 8.315 grams as follows:
1 gram .............> 1000 mg
8.315 grams ....> ?? mg
amount in milligrams = (8.315*1000) / 1 = 8315 milligrams

Hope this helps :)
5 0
3 years ago
How do Newton's laws of motion explain why it is important to keep the ice smooth on a hockey rink so that players
andriy [413]

Answer:

How do Newton's laws of motion explain why it is important to keep the ice smooth on a hockey rink so that players can pass a puck as quickly as possible? Smooth ice reduces the unbalanced forces that would slow the hockey puck. A skydiver falls toward the ground at a constant velocity.

Explanation:

3 0
3 years ago
Read 2 more answers
State the color of methyl orange in a sample of NaOH
devlian [24]
I just need points I hate my sister
5 0
3 years ago
Other questions:
  • Chromic acid (H2CrO4) is an acid that is used in ceramic glazes and colored glass. The pH of a 0.078 M solution of chromic acid
    11·1 answer
  • Which alkaline earth metal is part of the reaction process of photosynthesis answers?
    7·1 answer
  • Label the chemical equation.
    9·1 answer
  • Which of the following is NOT an example of a physical change? *
    5·1 answer
  • Question: Soil formation begins with the weathering of _________________?
    7·1 answer
  • Of molecules didn't exist how would life be different
    7·2 answers
  • How many atoms are in 4Ca(NO3)2
    7·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Which phrase best defines a covalent bond?
    15·1 answer
  • pls help ! If I have 17 moles of gas at a temperature of 67°C, and a pressure of 5.34 atmospheres, what is the volume of the gas
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!