1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
riadik2000 [5.3K]
3 years ago
12

Describe two or three ways in which the measurements you made could lead to errors in the results. Explain how each error would

affect the answer of molar mass. In other words, would the molar mass go up or down and why
Chemistry
1 answer:
mezya [45]3 years ago
3 0

Answer:Physical and chemical laboratory experiments include three primary sources of error: systematic error, random error and human error

Explanation:

When examining the root mean square speed equation, we can see that the changes in temperature (T) and molar mass (M) affect the speed of the gas molecules. The speed of the molecules in a gas is proportional to the temperature and is inversely proportional to molar mass of the gas.

You might be interested in
Which is a sign of a chemical change?
Igoryamba
The correct answer for the question it is option  

>>>>D<<<<

%100 sure 

if you need another answer welcome to come

7 0
3 years ago
Legend says that archimedes, in determining whether or not the king's crown was made of pure gold, measured its volume by the wa
amm1812
Mass=volume x density
if we have mass and density we can calculate volume using the formula: volume=mass/density
volume of the displaced water = 600g/19.3g/cm3
volume = 31.09cm3
6 0
3 years ago
explain observation made when anhydrous calcium chloride and anhydrous copper (ii) sulphate are separately exposed to the atmosp
Burka [1]

Answer:

Anhydrous calcium chloride  dissolves and becomes liquid

Anhydrous copper (ii) sulphate will produce crystal particles

Explanation:

Anhydrous calcium chloride is deliquescent and hence when it is exposed to air, it absorbs water from air. After absorbing water, it dissolves and after some time a pool of clear liquid appears.

Anhydrous copper (ii) sulphate will form crystal structures  and the following reaction will takes place

CuSO4 + 5 H20 --> CuSO4.5H2O

6 0
3 years ago
Given the following equation: 2C6H6 + 1502 - 12CO2 + 6H20
Margarita [4]

Answer:

a) 30 moles

Explanation:

                           2C6H6 + 1502 -------> 12CO2 + 6H20

from reaction      2 mol       15 mol

given                    4.0 mol     x mol

x = 4.0*15/2 = 30. mol

5 0
3 years ago
At some temperature, the reaction: 3 clo- ? clo3- 2 cl- has an equilibrium constant kc = 3.2 x 103. if the components of this re
Scilla [17]
Gagagagaagagry rftdadadad
4 0
3 years ago
Other questions:
  • How to know what elements are least likely to form ions?
    12·2 answers
  • 8. A sample of sulfur has a mass of 223 g. How many moles of sulfur are in the sample?
    9·1 answer
  • Which two substances are covalent compounds? * C6H12O6(s) and KI(s) C6H12O6(s) and HCl(g) KI(s) and NaCl(s) NaCl(s) and HCl(g)
    11·1 answer
  • Can someone help me with this research for the topics plz help. If everything is properly done then I will mark the brainliest a
    11·1 answer
  • WILL GIVE POINTS AND BRAINLIEST<br> Question:<br> Number of H− ions in 5.22 g of SrH2
    11·1 answer
  • Please help urgent !!! How does an instant cold pack get cold so quickly?
    5·2 answers
  • 11. The back part of the cerebrum deals with hearing<br><br> True<br><br> False
    7·1 answer
  • ¿Cuánto calor es necesario suministrar a 2 kilogramos de aluminio para que eleve su temperatura 20°C?
    10·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Endler's Guppies Experiment on Natural Selection
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!